Biology
5th Edition
ISBN: 9781260487947
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 13.3, Problem 1EQ
Summary Introduction
To determine: Whether the mex-3 mRNA corresponds to the sense strand or antisense strand in the given experiment.
Introduction: Fire and Mello conducted an experiment which showed that specific mRNAs are inhibited from translation by targeting them through a mechanism that uses a double-stranded RNA. Their experiment proved that for silencing mRNA, double-stranded RNA can be used instead of antisense RNA.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
What is the minimum length of time required for the synthesis by E. coli polymerase of an mRNA encoding a 100- kDa protein?
What is the experimental basis for concluding that puffs in polytene chromosomes and loops in lampbrush chromosomes are areas of intense transcription of RNA?
According to the scenario shown, how many segments of DNA (one, two, or three) are removed during site-specific recombination within the gene that encodes the κ (kappa) light chain for IgG proteins? How many segments are spliced out of the pre-mRNA?
Chapter 13 Solutions
Biology
Ch. 13.1 - Prob. 1CCCh. 13.2 - Prob. 1CCCh. 13.3 - Prob. 1EQCh. 13.3 - Prob. 2EQCh. 13.3 - Prob. 3EQCh. 13.3 - Effects of Non-coding RNAs on Translation and mRNA...Ch. 13.4 - Non-coding RNAs and Protein Sorting Core Skill:...Ch. 13.5 - Core Skill: Modeling The goal of this modeling...Ch. 13 - Prob. 1TYCh. 13 - Prob. 2TY
Ch. 13 - Prob. 3TYCh. 13 - Prob. 4TYCh. 13 - Prob. 5TYCh. 13 - Prob. 6TYCh. 13 - With regard to miRNAs and siRNAs, which of the...Ch. 13 - Cas1 and Cas2 proteins play a role during which of...Ch. 13 - Which of the following components bind to...Ch. 13 - Abnormalities in the expression of ncRNAs are...Ch. 13 - An ncRNA may have one or more of the following...Ch. 13 - What is RNA interference (RNAi)? Explain how the...Ch. 13 - Prob. 3CQCh. 13 - Prob. 1COQCh. 13 - Go to the PubMed website and search for non-coding...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A double-stranded fragment of viral DNA, one of whose strands is shown below, encodes two peptides, called vir-1 and vir-2. Adding this double-stranded DNA fragment to an in vitro transcription and translation system yields peptides of 10 residues (vir-1) and 5 residues (vir-2). Solve, (b) Determine the amino acid sequence of each peptide.arrow_forwardIn a heteropolymer experiment using 1/2C:1/4A:1/4G,how many different triplets will occur in the syntheticRNA molecule? How frequently will the most frequenttriplet occur?arrow_forwardWhich of the following set(s) of primers a-d could you use to amplify the following target DNA sequence, which is part of the last protein-coding exon of the CFTR gene? Explain briefly. (Note: The three dots represent the body of the region to be amplified, whose beginning and end are only being shown.) 5' GGCTAAGATCTGAATTTTCCGAG . TTGGGCAATAATGTAGCGCCTT 3' 3' CCGATTCTAGACTTAAAAGGCTC . AACCCGTTATTACATCGCGGAA 5' a. 5' GGAAAATTCAGATCTTAG 3'; 5' TGGGCAATAATGTAGCGC 3' b. 5' GCTAAGATCTGAATTTTC 3'; 3' ACCCGTTATTACATCGCG 5' c. 3' GATTCTAGACTTAAAGGC 5'; 3' АССCGTTATTАСАТСGCG 5 d. 5' GCTAAGATCTGAATTTTC 3'; 5' TGGGCAATAATGTAGCGC 3'arrow_forward
- To identify the following types of genetic occurrences, would acomputer program use sequence recognition, pattern recognition,or both?A. Whether a segment of Drosophila DNA contains a P element(which is a specific type of transposable element)B. Whether a segment of DNA contains a stop codonC. In a comparison of two DNA segments, whether there is aninversion in one segment compared with the other segmentD. Whether a long segment of bacterial DNA contains one ormore genesarrow_forwardRefer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?arrow_forwardWhat would be the modifier to add to this HCPCS code?arrow_forward
- You would like to add a nuclear localization sequence (NLS) of Lys-Lys-Lys-Arg-Lys to a protein that is usually found in the cytoplasm of a yeast cell. To accomplish this, you introduce the nucleotide sequence encoding the NLS into the gene that encodes the cytoplasmic protein of interest. a. What is the size of the nucleotide insert that will encode the NLS? Briefly explain. 5' 3' b. Below is a diagram of the gene encoding the cytoplasmic protein of interest in the yeast genome. If your goal is to put the NLS at the carboxyl (C) terminus of the protein, at which location (A-E) should the NLS be inserted? Briefly explain. A TATAA ATATT promoter +1 B ATG TAC D TAA ATT stop codon E 3' 5'arrow_forward(c) By binding one L-tryptophan molecule/monomer, the trp repressor binds to DNA to suppress syn- thesis of L-tryptophan in E. coli. Below is the amino acid sequence of the helix – (reverse) turn – helix region of the trp repressor that binds to DNA compared to the sequence of the corresponding DNA binding motif of the Prl protein, a different type of repressor protein. A diagram of the trp repressor dimer is also shown. reverse turn trp helix 4 70 Trp -Gly-Glu-Met-Ser-Gln-Arg-Glu-Leu-Lys-Asn-Glu-Leu-Gly-Ala-Gly- Ile- Prl -Ser-Glu-Glu-Ala-Lys-Glu-Glu-Leu-Ala-Lys-Lys-Cys-Gly-Ile-Thr- Val- Pri heilix trp helix 5 80 90 Trp Ala-Thr-Ile-Thr-Arg-Gly-Ser sgn-Ser-Leu-Lys-Ala-Ala- Prl Ser-Gln-Val-Ser-Asn-Trp-Phe-Gly-Asn-Lys-Arg-Ile-Arg- Prl helixarrow_forwardThe protein encoded by the cystic fibrosis gene is 1480amino acids long, yet the gene spans 250 kb. How is thisdifference possible?arrow_forward
- The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ Q. Is this terminator rho independent or rho dependent?arrow_forwarda) The best vector to use determine receptor binding protein expression would have been one with a GFP gene (green flourescent protein) attached. State one (1) reason why including this gene would have made the experiment easier and whether you have inserted the receptor binding domain gene before or after the GFP gene. b) You wish to determine the sucess pf your transformation by detecting the presence of receptor binding domian mRNA. Describe the key steps of the hybrdization technique you would use, clearly stating how you would design the probe to detect your receptor mRNA.arrow_forwardRecall from the central dogma that DNA codes for mRNA, which then codes for protein. Also recall that directionality matters! DNA 3' TAC - CTA -AAT - TGC - TCG-ATT 5' mRNA 5' ???- ???- ???- ???- ???- ??? 3' protein ? ? ? ? ? (A) Indicate whether the DNA sequence provided is the sense strand or the antisense strand. ? that (B) For the DNA sequence given above, write out the mRNA sequence that results. (C) Now write the amino acid sequence that results from the mRNA sequence you wrote in part (B). Use the three-letter abbreviations for the amino acids. (D) What happens if the A that is bolded and underlined in the given DNA sequence is mutated (changed) to a C? How is the protein affected? This can be answered in a few words, but be specific! (E) Now let's pretend for a moment that the protein being affected is ATP-ADP translocase. What, if anything, would happen to the citric acid cycle? This should be answered in a few words/one sentence max.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY