TRUE or FALSE: "The initiation codon for both prokaryotes and eukaryotes is AUG coding for the same amino acid - methionine."
Q: fill in the blanks Metabolism of one glucose molecule yields ( ) molecules of acetyl…
A: Glycolysis is very important and common metabolic pathway which converts glucose into pyruvic acid…
Q: The following figure depicts the breakdown of purine nucleotides, which are the nucleotides with…
A: Introduction: Uric acid is the end product of purine metabolism and is excreted by the kidneys. Gout…
Q: What are the benefits and risks of taking supplements?
A: Supplements are generally of three type dietary supplements, bodybuilding supplements and herbal…
Q: Read each pair of sentences and then choose the letter of the correct answer. Your answer must be in…
A: Glycolysis is a cytoplasmic pathway. In this pathway glucose is broken down into two three-carbon…
Q: Glucose is frequently administered intravenously (injected directly into the bloodstream) to…
A: By hydrolysis of glucose (glycolysis) a cell yields required energy.
Q: Due to a nucleotide substitution, the fourth residue of H3 in a specific tissue cell of an organism…
A: Protein domains are the structural units of protein that are responsible for specific function of…
Q: In a TABLE FORMAT Compare DNA and RNA as to structure and components.
A: DNA is the deoxyribonucleic acid and RNA is ribose nucleic acid. DNA is the important component in…
Q: I need answer within 20 minutes please please with my best wishes
A: After an intake of carbohydrates there will be an increase in the concentration of the glucose…
Q: BSA (mg/ml) Absorbancy 540nm 0.158 1 0.210 2 0.260 3 0.305 4 0.360 5 0.410 0.455 7 0.510 8 0.530…
A: The determination of protein concentration is a fundamental technique in biochemical analysis.
Q: Common structural feature of Chitin and Amylopectin and Differences of chitin and amylopectin
A: The polysaccharides molecules are monosaccharides that are connected by glycosidic linkages.
Q: After an MRNA primary transcript is created, a modified guanine nucleoside triphosphate is added to…
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: Explain the reason for each of the following rules regarding micropipettes. a) Always set the…
A: A micropipette is a laboratory Instrument used to transfer precise and accurate volumes of…
Q: 7. A 35-year-old villager with IDDM was examined in the hospital and assured the endocrinologist…
A: IDDM (insulin dependent diabetes mellitus) : it is an autoimmune diseases in which insulin producing…
Q: QUESTION 2 The Bradford method described in the Background section was used to determine protein…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Complété thế table Biosynthesis Sources Functions Deficiency oxicity
A: Introduction: Vitamins are important organic nutrients required in minimal amounts for normal…
Q: After an MRNA primary transcript is created, a modified guanine nucleoside triphosphate is added to…
A: In the early mRNA elongation process, the 5' end of the nascent pre-mRNA is modified by addition of…
Q: 9. What is the purpose of the following? a) spliceosomes b) RNA polymerase c) Protein release…
A: The central dogma of molecular biology involves the processes of transcription and translation that…
Q: e Galapagos islands over four generations. How can you explain this ta using your knowledge of…
A: In Galapagos island, these finches (Darwin's finches) adapted various beak sizes depending upon…
Q: For each of the heterocyclic bases, choose a correct characterization from the response list…
A: Nucleic acids are the polymer of nucleotides. Nucleotide is made up of ribose or deoxyribose sugar,…
Q: During carbon dioxide transport, a typical Bohr effect takes place at the _________ when ________…
A: Bohr effect - The effect of pH and CO2 concentration on the binding and release of oxygen by…
Q: You obtained the following raw data when setting up a Bradford standard curve: BSA (mg/ml)…
A: The Bradford protein assay is a colorimetric assay using the Bradford reagent (acidified Coomassie…
Q: The aldolase reaction cleaves fructose-1,6-bisphosphate to make G-3-P and DHAP. Draw the structures…
A: Aldolases are divided into two classes based on their reaction mechanism: class I and class II. The…
Q: Indicate whether the following compounds is positive or negative in the Benedict’s test: 1.…
A: Carbohydrates are divided into 3 classes monosaccharides, disaccharides, and…
Q: Researchers isolated a yeast phosphofructokinase (PFK) mutant in which a serine at the…
A: The enzyme phosphofructokinase converts fructose-6-phosphate into fructose-1,6-bisphosphate. This is…
Q: What are the functions of the following steps in the purification and isolation of proteins:…
A: The lysis of cells is the first step in the purification of a cellular protein.
Q: 1. Indicate the effect of insulin and glucagon on the following metabolic processes. Write INCREASE…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: Identify at least five biological effects of disorders of the citric acid cycle
A: In our body their are lot of metabolism pathways are carried out apart from them citric acid cycle…
Q: Which of the following is true? Group of answer choices All prokaryotes have a common genetic code,…
A: The amino acid sequence of proteins is determined by the sequence of nucleotides in deoxyribonucleic…
Q: Illustrate the relationship between the following: Vitamin E, Vitamin C, Glutathione, alpha-lipoic…
A: Oxidative stress is a condition in which the concentration of reactive oxygen species (ROS),…
Q: 31. AN ENZYME WHICH IS A LOW MOLECULAR WEIGHT AND DIALYZABLE? A. APOENZYME B. HOLOENZYME C.…
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Calculate the GI50 value from the graph showing different concentrations of N3P. Show full working.…
A: The concentration of an inhibitor causing 50% cell growth inhibition is called GI50 of the…
Q: 1. Transcription: Write out the sequence of mRNA that would result from transcription of the…
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: 2. For an exergonic reaction, what is the value of AG?
A: The ∆G of exergonic reactions is a negative value, the change in Gibbs energy result is negative.
Q: Identify the name of the amino acid and its group (aliphatic, aromatic, acidic, basic, hydroxylic,…
A: Amino acids are the building blocks of proteins. The amino acid is composed of, a carboxyl group, a…
Q: ACTIVITY 9.4 Complete the table Vitamin Coenzyme it forms (or helps)
A: Some enzymes require the participation of coenzymes for their activity.
Q: Total protein: Do you think that refractive index could be used as a regular method for serum…
A: Serum total protein determination is a biochemical test for measuring the total amount of protein in…
Q: Chemistry A biomolecule has a K_d of 1.6mM. A mutated-version of the same biomoleucel was bound by…
A: [P] + [L] → [PL] Dissociation constant, Kd = [P] [L] / [PL] Dissociation constant (Kd) - is…
Q: Describe what would happen to the lac operon in a low-lactose environment and in a high lactose…
A: LacZ (encodes beta-galactosidase), lacY (permease), and lacA (trans-acetylase) are the three genes…
Q: Describe the control of the Different changes DURING PROCESSING AND STORAGE?
A: The fundamental chemical adjustments happening in ingredients all through processing and storage,…
Q: If a phage is undergoing lytic growth, which protein is bound to the operator region? O Both Lambda…
A: Phages are the vruses that infect Bacteria. They have been widely studied for the aspects like gene…
Q: ) Two ribose subunits are present in the coenzyme flavin adenine dinucleotide. (2) In the common…
A: Flavin adenine dinucleotide is a coenzyme form of the vitamin adenine or B2, with a formula of…
Q: Kindly refer to the image and answer the question 5. Cite a metabolic pathway where active protein…
A: Protein kinases are the Enzymes that phosphorylate the Target protein by adding a phosphate group.…
Q: On average, 180 liters of plasma are filtered each day. A. If humans had to expend one molecule of…
A: Plasma is classified as the largest constituent that is present in the blood. It has a light…
Q: ow many grams of a 1:3 mixture of glucose/glycerine would be required to make 2000mL of water…
A: Glucose is an essential component of the body and is known as blood sugar. Glycerin is used as a…
Q: Explain the importance of protein denaturation.
A: Proteins are one of the most important macromolecule in living organisms with high molecular weight…
Q: dentify any five junk foods you have taken from the last weekwhat lind of good foods can be the…
A: Introduction: A healthy diet is one that helps us to maintain or improve our health. It is necessary…
Q: 3. Tourists miscalculated lood supplics and have been starving lor 2 days belore reaching a…
A: When subjected to prolonged period of starvation, level of glucose in blood falls. This happens…
Q: On average, 180 liters of plasma are filtered each day. A. If humans had to expend one molecule of…
A: ATP stands for Adenosine triphosphate. The molecular formula of this compound is found to be…
Q: Q 6) Consider that the radius of the blood vessel has decreased to (80%) of its original value due…
A: We know that blood moves from high pressure to low pressure. Heart pumps blood into the arteries…
Q: 10. It was found that At coordinates to a metal in a 4:1 stoichiometry. Noting that A has a ba…
A: Biological important of coordination compounds like the heme group, which is Fe-Porphyrin complex…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
TRUE or FALSE: "The initiation codon for both prokaryotes and eukaryotes is AUG coding for the same amino acid - methionine."
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- True or false: A fully assembled 70S ribosome is recruited to the mRNA just 5 ́ of the translation start site?True or False: Proteins are assembled two or three amino acids at a time during translationMRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Code-End of the Amino Acid MRNA Codons* (anticodon) tRNA Alanine GCU AGA Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid Glutamine Glycine Histidine AAU GAU UGU GAA CAA GGU CAU AUU CUU AAA AUG Isoleucine Leucine Lysine Methionine UUU Phenylalanine Proline CCU UCU Serine ACU UGG Threonine Tryptophan Tyrosine Valine UAU GUA There are 64 codons. Some amino acids have several mRNA codor There is, however, no overlap of codes.
- True or false Both pentose nucleic acid and deoxypentose nucleic acid contain the same pyrimidines Both pentose nucleic acid and deoxypentose nucleic acid and deoxypentose nucleic acid Contain the same purines RNA contains cytosine and thymine DNA and RNA are hydrolysed by weak alkali The anticodon of tRNA finds the complementary codon on mRNA The amino acid is attached to end of tRNA The amino acid is recognized by the anticodon of tRNA A given tRNA can be charged with only one particular amino acidIf a codon GCA codes for the amino acid alanine in a prokaryote, what will it code for in a eukaryote? _____DNA A G T A C C G G G C A A A C T G C A T T G T G mRNA U C A U G G C C C G U U U G A C G U A A C A C Use the "Genetic Code Chart" to determine the sequence of amino acids in your polypeptide chain. Remember to START translation at the start codon by adding a Methionine and STOP translating when you reach a stop codon.
- MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Code-End of the MRNA Codons* (anticodon) tRNA Alanine GCU Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid AGA AAU GAU UGU GAA Glutamine CAA Glycine Histidine GGU CAU Isoleucine AUU Leucine CUU Lysine Methionine AAA AUG Phenylalanine Proline UUU CCU Serine UCU Threonine ACU Tryptophan Tyrosine Valine UGG UAU GUA * There are 64 codons. Some amino acids have several mRNA codons. There is, however, no overlap of codes. 1. You should be able to fill in the 3-letter "code-end" of the tRNA molecules in the table above. Remember, in RNA A pairs with U, and G pairs with C. There is no thymine. Fill in the table.Given the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…The following segment of DNA in a hypothetical model organism encodes a polypeptide containingSEVEN amino acids. Pretend this short polypeptide is a completely functional enzyme. DNA tripletsencoding the translation initiation (or start) codon and a stop codon are included in the sequence.3 •GGGTACGATCGGAAAGTTGGTTCICCGGTATAGCTG5'5•CCCATGCTAGCCTTTCAACAAAGAGGCCATATCGAC.3'a. Label which of the DNA strands is the template strand and which is coding strand. b. Below, show sequence and the polarity of the mRNA encoded by this 'gene'. Determine theamino acid sequence of the polypeptide (use three letter codes for the amino acids) andidentify the N- and C- terminal ends of the polypeptide. please help. I am confused. c. Which of the 7 side chains in this polypeptide can form hydrogen bonds with polar molecules(like water)? Place a circle around these.d. Some amino acids on a polypeptide can be modified post-translationally. Thesemodifications may have some effect on the function of the…
- Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’True or False: When determining the transcription start site, there is a nucleotide position numbered zero. True False