Second Base Analyze the following DNA sequences: A UUU UCU UAU UGU Phe Tyr UUC UCC UAC UGC Original: AGAGAGAGAGAGAGAGAG Ser UUA UCA UAA Stop UGA Stop Leu UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU His Mutated: AGAAGAGAGATCGAGAGA CUC CC CAC CGC Leu Pro Ang CỦA CCA CAA CGA Gin CUG CCG CAG CG AUU ACU AAU AGU Asn Ser What amino acid sequence will be translated based on the AUC Ile ACC AAC AGC The mutated DNA? Hint* must transcribe and translate the AUA ACA AAA AGA Arg Met or Start AUG ACG AAG AGG mutated strand to find the answer. GUU GCU GAU GGU Asp GUC GCC GAC GGC Va Ala Gly G GUA GCA GAA GGA Glu GUG GCG GAG GG First Base A

Q: A piece of DNA fragment is sequenced. You clone the the fragment, isolate the cloned DNA fragment,…

A: While deciphering a sequencing gel, we know that it depends on terminating the reaction at 3' end…

Q: Which 2 primers will copy the entire sequence of DNA: 5'…

A: Primer is a short nucleotide sequence which is required to initiate DNA replication . To the primers…

Q: 1000bg 800b 500bd 300bd 100bg Identify the sizes of the DNA bands in the agarose gel above using the…

A: Agarose gel electrophoresis is a separation technique mostly used for DNA molecules. Where a sample…

Q: Transcribe and Translate the DNA strand: ORIGINAL DNA TAC/ACC/TTG/GCG/ACG/ Strand: RNA strand: Amino…

A: Transcription is the process in which m RNA is synthesized and the translation is the process in…

Q: Given the DNA strand with sequence 5' AUGGAGGAUGGCCAGUCAAUUUGA 3' match the various mutations to the…

A: Codon is a sequence of three nucleotides that corresponds to a specific amino acid. Codons encode…

Q: Figure 9-22 shows the first steps in the process of making a DNA microarray, or DNA chip, using…

A: A DNA microarray is also known as the DNA chip, is the high throughput method that is used to trace…

Q: For the chromatogram below, what is the sequence of the template DNA from base 115 to 125?…

A: According to the question, we have to answer the question that which is for the chromatograph below,…

Q: You are interested in amplifying the putative gene encoding the 480-bp protein TMR (Total Memory…

A: We are given with the gene that is needed to be amplified by PCR. The image shows a region of DNA…

Q: Below are fragments from a shotgun sequencing run of a single chromosome. On a separate piece of…

A: Here we provide you the Number of contigs formed from given sequences and the sequence of exon 3…

Q: Identify the mutation. Original DNA: TAC CCG AAT GGC ATT Mutated DNA TAC CCG AAC GGC ATT Use the…

A: To identify: The mutation in the given DNA sequence

Q: 1) You would like to clone a gene by PCR. The sequence of the two ends of the coding strand for the…

A: A laboratory technique for amplifying DNA sequences is polymerase chain reaction (PCR). The approach…

Q: A linear piece of DNA was broken into random, overlapping fragments and each was sequenced. The…

A: Introduction DNA is an organic chemical that contains genetic information as well as instructions…

Q: The gel pattern below was produced by the Sanger sequencing method. Determine the sequence…

A: In sanger Sequencing, the products of the nucleotides A, G, C, and T reactions are individually…

Q: Sequencing of the following fragment of single-stranded DNA needs to be undertaken using the Sanger…

A: Sanger sequencing, also referred to as the “chain termination method”, may be a method for…

Q: Here is a nucleotide sequence: ATGCAAGGTT. Choose the answer that correctly identifies both the type…

A: DNA and RNA are two nucleic acid polymers found in all living cells. Both are made up of nucleotide…

Q: EcoRI Sacl Kpnl Aval ampR Xmal Smal lacZ BamHI Xbal Sall Accl HinclI Pstl Sphl HindIII Bam H1 Bam H1…

A: Answer :- Option (C) is correct. - 1. :-

Q: A researcher wants to cut this piece of linear DNA. 5'…

A: The restriction enzymes are the specific enzymes that act on the DNA molecule and perform its…

Q: sequence shown below is the 5' to 3' strand of a dsDNA template. You are asked to design PCR primers…

A: The polymerase chain reaction (PCR) is a laboratory (in vitro) technique for generating large…

Q: Proofreads each nucleotide its template as soon as it is added to the growing strand. A) DNA Ligase…

A: DNA is a genetic material that uses transcription and translation to transfer genetic information to…

Q: Below are fragments from a shotgun sequencing run of a single chromosome. On a separate piece of…

A: This sequencing is a laboratory technique used for the determining of DNA sequence of an organism's…

Q: A linear piece of DNA was broken into random, overlapping fragments and each fragment was sequenced.…

A: An overlapping gene fragment is a gene whose nucleotide sequence partially overlaps with that of…

Q: 17. You are presented with the following DNA molecule: 5 ATGCGATTATAA 3' 3' TACGCTA ATATT5' A. Write…

A: Given: A DNA Molecule: 5' A T G C G A T T A T A A 3' 3' T A C G C T A A T A T T 5' DNA =>…

Q: Sequencing reactions are done in separate tubes for each ddNTP with a radioactive primer. Which…

A: In our Desire primer it  is 15 nucleotide long however on gels there are only 10 bands are present…

Q: Template DNA: 5’ ATGACGGAATATAAGCTGGTGGTGGTGG---GGCTGCATGAGCTGCAAGTGTGTGCTCTCCTAA 3’ 3’…

A: Template DNA: 5’ATGACGGAATATAAGCTGGTGGTGGTGGGGCTGCATGAGCTGCAAGTGTGTGCTCTCCTAA 3’…

Q: Below is a small stretch of DNA in the middle of a gene. What amino acid sequence would be encoded…

A: Amino acids are the organic compounds that contain amino group and carboxyl group functional groups…

Q: In which reagent is extracted DNA suspended to put it in solution? A. Sodium citrate saline buffer…

A: In which reagent is extracted DNA suspended to put it in solution?   A. Sodium citrate saline…

Q: A DNA fragment with the following base sequence has some cytosine bases that are methylated…

A: The bisulfate sequencing is the treatment of DAN with bisulfite before the routine sequencing for…

Q: Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of…

A: The molecule, which is responsible for the genetic inheritance in most living organisms is…

Q: The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion…

A: DNA molecule is the genetic material present in the animals. Genetic material  is present in the…

Q: Write the sequences of the two 12-residue primers that could be used to amplify the following DNA…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: These sequences are obtained as part of a human genome sequencing project using a library of 150 kb…

A: Contigs are the overlapping sequences present on DNA fragments. Each set of contigs is counted as…

Q: Ruwaifa want to compares a nucleotide query sequence what option he will opt in BLAST and why?

A: BLAST is Basic local alignment search tool used to compare the queries in a DNA database. They are…

Q: The Sanger products in the sequencing of a template DNA is shown below: +ddTTP +ddATP +ddCTP +ddGTP…

A: Sanger method of DNA sequencing is a chain termination method of DNA sequencing in which…

Q: When the cDNA was sequenced by the Sanger method utilizing ddCTP, the following products were…

A: Answer :: If the dCTP was not present, the polymerization would come to a standstill, resulting…

Q: For the chromatogram below, what is the sequence of the template DNA from base 115 to 125? CTGTGTGAA…

A: DNA is formed of four types of nitrogenous bases, which are adenine, thymine, guanine, and cytocine.…

Q: Sequencing reactions are done in separate tubes for each ddNTP with a radioactive primer. Which…

A: Gell electrophoresis is a biological apperatus mainly used in biotechnology or in case of genetic…

Q: #2 EcoRI --- 5’ G ↓AATTC 3’   5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’  3’ TGC…

A: Restriction enzymes is an enzyme that cleaves DNA into fragments. Recognition sequence is a unique…

Q: The following nucleotide sequence is found on the template strand of DNA. First, determine the amino…

A: Amino acids are the amine groups consisting of carboxylic acids and a side chain which forms the…

Q: The following DNA fragment shows where a number of restriction endonucleases cut sites occur within…

A:

Q: Image 1. Which 2 primers from the choices provided would work to amplify the DNA sequence given…

A: DNA strand for deoxyribose nucleic acid. It is the genetic material present in the cell.

Q: The following DNA fragment shows where a number of restriction endonucleases cut sites occur within…

A: Restriction endonuclease Restriction endonucleases also called restriction enzymes are defined as…

Q: To achieve a 10x depth coverage for a genome of length 10 Mbp, how many reads of 100 bp are…

A: A Coverage is multiplier based on  total size of the genome. Formula =  Coverage = (read length) x…

Q: Below are 9 possible primer pairs. ● Determine which primer pair is the best choice. ● Explain why…

A: Primers are used in the PCR or polymerase chain reaction. These primers anneal at a particular…

Q: A cloned fragment of DNA was sequenced by using thedideoxy chain-termination method. A part of the…

A: The process is usually defined as the way that they are been determining the sequence of nucleotides…

Q: Given the electrophoresis profile of a Sanger sequencing result, what was the sequence of the…

A: The correct option is b 5'CCATTGG3'. Sanger sequencing ( method of DNA sequencing and it involves…

Q: Given the banding pattern from the gel electrophoresis below, the nucleotide sequence of this…

A: Gel-electrophoresis:- it is used to separate the fragments of DNA, RNA, as well as proteins on the…

Q: In order to determine the purity of a DNA sample. spectrophotometry can be carried out at _______ to…

A: DNA yield and purity is measured by absorbance. Absorbance is measured  by spectrophotometer.

Q: Suppose that you want to sequence the following DNA fragment: 5′–TCCCGGGAAA-primer site–3′ You first…

A: The sequencing involves replicating the desired sequence to be sequenced in the presence of the…

Q: Given the banding pattern from the gel electrophoresis below, the nucleotide sequence of this…

A: Electrophoresis separates the DNA strands based on their size. Thus, the smaller fragments sieve…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.