Image 1. Which 2 primers from the choices provided would work to amplify the DNA sequence given below ? 5’ACTGAGTCCATGCGATCATGACTAT 3’ 3’TGACTCAGGTACGCTAGTACTGATA 5’ this is a hypothetical example. In a real experiment Choose 5’ TGAC 3’ 5’ CTAT 3’ 5’ ACTG 3’ 5’ ATAG 3’ Image2. the template strand?The results of a gel-based sequencing experiment are shown below. What is the sequence, written Only include nucleotides (no spaces or numbers )
Q: 5) PCR primers have a melting temperature (Tm) at which they become dissociated from the template…
A: A primer is a short strand of nucleotide molecules that serves as an initial point for the synthesis…
Q: How can DNA microarrays be used to determine which genes of a bacterial pathogen are expressed both…
A: DNA microarray or biochip is a technique wherein different DNA molecules are first attached to a…
Q: . The table opposite shows the standard (coding strand) DNA rinlet codes for the 20 amino acids…
A: Introduction :- The process of protein synthesis occurs in two steps which are transcription and…
Q: 2 Make a drawing of the simple recombinant plasmid PAMP/PKAN containing only the 3755bp and 1875bp…
A: One intriguing scenario is the union of the 3755-bp pAMP fragment with an origin of replication for…
Q: Which 2 primers will copy the entire sequence of DNA: 5'…
A: Primer is a short nucleotide sequence which is required to initiate DNA replication . To the primers…
Q: ЗА. This DNA after Bsal digestion, produces a DNA fragment with sticky ends as shown in the figure…
A: Introduction :- DNA strands are digested with the help of various restriction enzymes .Bsal is an…
Q: You are cloning the genome of a new DNA virus into pUC18. You plate out your transformants on…
A: Molecular cloning is a technique by which a gene of interest is inserted into a plasmid vector,…
Q: 1. Below is a partial sequence of a guide RNA. The underlined section of the RNA is designed to…
A:
Q: Prior to the action of DNA ligase, how many hydrogen bonds are holding these two DNA fragments…
A: Introduction DNA strand is composed of three components: Deoxyribose Sugar Nitrogenous Bases…
Q: 1) You would like to clone a gene by PCR. The sequence of the two ends of the coding strand for the…
A: A laboratory technique for amplifying DNA sequences is polymerase chain reaction (PCR). The approach…
Q: 2. Dr. Kim at Research Center performed shotgun Sanger sequencing on an unknown DNA sample, and…
A: In conventional sequencing method, in a reaction mixture, single-stranded molecules of the DNA,…
Q: 4.8. The figure below shows a snippet of DNA in the process of being replicated. The RNA primer is…
A: DNA replication is the process by which DNA makes a copy of itself during cell division. In order to…
Q: A K I D H
A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…
Q: 1. (a) What will be the newly synthesized DNA from the template given? DNA Template 3 -…
A: The base-pairing rule in DNA is that cytosine (C) pairs with guanine(G) and adenine (A) pairs with…
Q: The schematic diagram below shows the functional organization of transcribing RNA polymerase. Match…
A: Transcription is the next step after replication in the central dogma of biology. It is the process…
Q: A fragment of DNA is cloned into a plasmid witha sequencing primer binding site. After dideaxy…
A: DNA sequencing is a process of identifying the order of nucleic acid bases i.e. adenine, guanine,…
Q: The complementary strands of DNA in the double helixare held together by hydrogen bonds: G ≡ C or A…
A: DNA double helix is formed by the hydrogen bonds formed between the base pairs. Adenines forms two…
Q: Which of the following correctly describes a difference between RNA & DNA polymerases? RNA…
A: Transcription is the biological process of copying a segment of DNA into RNA, for example mRNA that…
Q: Draw a diagram showing what pGEM will look like after it has been digested with BamHI.
A: BamHI: BamHI is a restriction enzyme obtained from Bacillus amyloliquefaciens that specifically cuts…
Q: Figure 25: MCS of PUC19 A. If the MCS were cut with Kpn I and BamH I, draw the small fragment of DNA…
A: pUC19 is a plasmid cloning vector developed by Joachim Messing. It is a 2686 base pair containing…
Q: Coding With the given coding strand perform the following 1. supply the correct non- coding strand…
A: DNA is a double helical molecule.
Q: 17. You are presented with the following DNA molecule: 5 ATGCGATTATAA 3' 3' TACGCTA ATATT5' A. Write…
A: Given: A DNA Molecule: 5' A T G C G A T T A T A A 3' 3' T A C G C T A A T A T T 5' DNA =>…
Q: The sequence below shows the ends of one strand of a linear chromosome, with slashes representing…
A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…
Q: Consider the RNA sequence 5' AUGUUAGAUCGG 3' transcribed from the DNA molecule below. 1. 5'…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: Which is the odd one out ? For the rest, explain the concept/process/technique they are involved…
A: DNA Polymerase is the main enzyme of replication. It adds deoxyribonucleotides according to the…
Q: Considering that DNA is synthesized in the 5' to 3' direction, which direction must DNA polymerase…
A: Introduction: Biological information is transferred from DNA to RNA and then to proteins. This is…
Q: You are trying to clone you favorite piece of DNA into the PUC vector shown above. You've pulled an…
A: Joachim Messing and colleagues developed a variety of plasmid cloning vectors, including pUC19. The…
Q: In which region(s) will Okazaki fragments be found during new strand synthesis? (see image for…
A: Semi replicative mechanism is a type of DNA mechanism which explained the type of replication…
Q: The chromatogram shows fluorescent peak data from a dye-terminating nucleotide-sequencing reaction.…
A: Sanger sequencing (also known as chain termination sequencing) is a DNA sequencing technology that…
Q: Please asap Original DNA template: 3'-ACGGTCAATTTGCTG-5 a) Transcribe the sequence. b) Translate the…
A: Given: Original DNA template: 3' - ACGGTCAATTTGCTG - 5'
Q: The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion…
A: DNA molecule is the genetic material present in the animals. Genetic material is present in the…
Q: The line below depicts a DNA segment from a eukaryote. In this case, only the top, coding strand, is…
A: Eukaryotic DNA is enclosed within a double membrane bound nucleus. In eukaryotic transcription,…
Q: The image below shows the replication bubble of a piece of DNA in the process of replication.…
A: DNA replication is the process to make copies of DNA. The new DNA strands are always synthesized…
Q: Please help me with the orange question. My answer is leading strand will encounter lagging strand.…
A: DNA replication takes place in a bidirectional mode in which both strands are replicated…
Q: All ingredients required for the synthesis of DNA were placed in a test tube. The primer has the…
A: This is the working process of DNA dependent DNA polymerase. DNA polymerase synthesize new DNA…
Q: most likely 11 nucleotides on this strand that serve as the replication origin
A: According to Chargaff's rules of base pairing stoichiometric ratio of purine and pyrimidine bases…
Q: 1. The following gel was produced in manual DNA sequencing. What would the unknown DNA template be…
A: The method of determining the nucleic acid sequence – the order of nucleotides in DNA – is known as…
Q: Draw a diagram showing what pGEM will look like after it has been digested with BamHI. Be sure to…
A: Answer
Q: For the chromatogram below, what is the sequence of the template DNA from base 115 to 125? CTGTGTGAA…
A: DNA is formed of four types of nitrogenous bases, which are adenine, thymine, guanine, and cytocine.…
Q: Which is the odd one out ? explain how the rest are connected. primers dNTPs DNA polymerase…
A: The polymerase chain reaction (PCR) is a widely used method for rapidly making millions to billions…
Q: 3. Look at the sequences below. If you add a restriction enzyme(that cuts at GAATTC) to the uncut…
A: as per our company guidelines we are supposed to answer only first 3 sub-parts. Kindly repost other…
Q: Suppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in…
A: Inversions are half-circle rotations of a region of a single chromosome. It is important to remember…
Q: 1. A linear DNA molecule is subjected to complete restriction digestion by (1) EcoR1 alone, (2)…
A: Restriction enzyme or restriction endonuclease are bacterial protein that cleaves DNA at specific…
Q: + DNA Fragment with Human Gene Recombinant Plasmid Plasmid Vector Bacterial DNA Recombinant Plasmid…
A: Since there are multiple questions in this particular question I will answer the first one for you.…
Q: Which is the odd one out ? For the rest, explain the concept/process/technique they are involved…
A: Introduction Enzymes:- These are proteins that help speed up metabolism, or the chemical reactions…
Q: Below is shown a plasmid map from a recombinant DNA experiment you have performed. You inserted your…
A: Electrophoresis is a technique used to separate macromolecules like DNA, RNA, and proteins based on…
Q: You want to make a recombinant DNA in which aPCR product amplified from the human genome is inserted…
A: PCR (polymerase chain reaction) is a technique mostly used in molecular biology to make millions to…
Q: Figure 3: BestrictriOR site map showing the following: A) linear DNA that is not cut as reference B)…
A: Restriction enzymes cut the DNA (deoxyribonucleic acid) at specific sites. These enzymes recognize…
Q: 8. You have a piece of DNA with the sequence shown below.…
A: EcoRI is one of the most commonly found restriction endonuclease and it is isolated from the E.…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- The chain terminator method was used to sequence the following DNA fragment: ACTGGGCATAAGCGGGAACTTTGCAGAACTGGCTGGCCTCAGAGCAGGGA. 1. Predict a band pattern in a gel after sequencing this DNA fragment using a radioactively labeled primer [32P]-5’- TCTGAGGCCAGCCAGTTCTGCAAAGTTC. 2. Due to an experimental mistake, dATP was not added in all four reaction mixtures. How does the band pattern change?Given: BamHI, cleaves after the first G: 5’ G GATCC 3’ 3’ CCTAG G 5’ AND BclI cleaves after the first T: 5’ T GATCA 3’ 3’ ACTAG T 5’ THEN -- Given the DNA shown below: 5’ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG3’ 3’TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC5’ i) If this DNA was cut with BamHI, how many DNA fragments would you expect? ii) If the DNA shown above was cut with the enzyme BclI, how many DNA fragment would you expect?Design primers that will amplify the following region of DNA (assume this is one strand from a double stranded region of DNA). The primers should be 15 bases in length. Indicate the 5' and 3' ends of the primers. 5' GGATCGATCAAGAACAATGACAGGATCGAGGAATTCAGCCTACGCAGCCCGTAGCTGGAGGGA 3'
- Design 6 bp primers to amplify the region of this sequence that is highlighted in yellow. attatatttt atattatata ctctgggctc agagcagccc 40 41 atattatata tatatatttt aaaatattat aaatttattt 80 81 cagtcacgcg tcctgatgac attatatttt ataatttttt 120 121 ttttattttt attatatttt aaaatattat aaatttattt 160 161 aaaatattat tatatattta aaatttattt attataaaat 200 201 aaaatattat ttttattttt gagatcagga cggctgcatg 240 Forward primer Reverse primerGiven the following double-stranded fragment of DNA: 5'- ACTTGGCAGGCCTTCGATCC-3' 3'- TGAАССGTCСGGAAGCTAGG-5' A hypothetical restriction endonuclease recognizes a 6bp sequence with two-fold symmetry (typical for restriction enzymes) found in this fragment and catalyzes cleavage of this DNA on both strands between GG nucleotides within the recognition sequence. This nuclease exhibits b-type cleavage (atypical for restriction enzymes). Draw the double-stranded sequence of each fragment after cleavage showing any phosphates left on the ends.For the following sequence design the forward and reverse primer... explain and justify your answer. Full sequence would be: 1 tctagagtca tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca ttctgcagca gcggcggcaa atcttaatgg gacgctgatg 121 cagtattttg aatggtacat gcccaatgac ggccaacatt ggaagcgttt gcaaaacgac 181 tcggcatatt tggctgaaca cggtattact gccgtctgga ttcccccggc atataaggga 241 acgagccaag cggatgtggg ctacggtgct tacgaccttt atgatttagg ggagtttcat 301 caaaaaggga cggttcggac aaagtacggc acaaaaggag agctgcaatc tgcgatcaaa 361 agtcttcatt cccgcgacat taacgtttac ggggatgtgg tcatcaacca caaaggcggc 421 gctgatgcga ccgaagatgt aaccgcggtt gaagtcgatc ccgctgaccg caaccgcgta 481 atttcaggag aacacctaat taaagcctgg acacattttc attttccggg gcgcggcagc 541 acatacagcg attttaaatg gcattggtac cattttgacg gaaccgattg ggacgagtcc 601 cgaaagctga accgcatcta taagtttcaa ggaaaggctt gggattggga agtttccaat 661 gaaaacggca actatgatta tttgatgtat gccgacatcg attatgacca tcctgatgtc 721 gcagcagaaa ttaagagatg gggcacttgg…
- Which of the following set(s) of primers a-d could you use to amplify the following target DNA sequence, which is part of the last protein-coding exon of the CFTR gene? Explain briefly. (Note: The three dots represent the body of the region to be amplified, whose beginning and end are only being shown.) 5' GGCTAAGATCTGAATTTTCCGAG . TTGGGCAATAATGTAGCGCCTT 3' 3' CCGATTCTAGACTTAAAAGGCTC . AACCCGTTATTACATCGCGGAA 5' a. 5' GGAAAATTCAGATCTTAG 3'; 5' TGGGCAATAATGTAGCGC 3' b. 5' GCTAAGATCTGAATTTTC 3'; 3' ACCCGTTATTACATCGCG 5' c. 3' GATTCTAGACTTAAAGGC 5'; 3' АССCGTTATTАСАТСGCG 5 d. 5' GCTAAGATCTGAATTTTC 3'; 5' TGGGCAATAATGTAGCGC 3'For the chromatogram below, what is the sequence of the template DNA from base 115 to 125? CTGTGTGAAA TTGT TA T C CGC T CACA A T TCCACA CA A CATACGAG CCGGAAG CA T AA 110 120 130 140 150 160 СТТТААСАAТА ТАTTCAATTТС ATAACAATTTC GAAATTGTTATTable I CACGT A GA CTGAGG ACTC CACGTAGACTGAG G ACAC Wild-type beta-globin gene fragment Sickle-cell beta-globin gene fragment > Circle the mutation in DNA of the sickle-cell beta-globin gene fragment Compare fragments of DNA the wild-type and mutant beta-globin genes in the Table I above, what are the similarities and differences you observe?
- The chromatogram shows fluorescent peak data from a dye-terminating nucleotide-sequencing reaction. The peaks are shown with shortest fragment on the left to longer fragments on the right. T •C A Select the DNA sequence that matches the data. 5-ТАТAСТТАСGAAGT-3' 5'-GTCCTACGGACGCG–3' 5'-ATATGAATGCTTCA–3' 5'-TGAAGCATTCATAT–3' 5-АСТТCGTAAGTATA-3'In Polymerase Chain Reaction (PCR), the temperature is one of the most important parameters that could influence the efficiency of this technique. Each cycle of this reaction has its own specific temperature. For instance, the denaturation step possesses a temperature of 94 - 98 ℃ to ensure that the double stranded DNA is fully separated. (i) (ii) (iii) Why is the annealing temperature vital in this technique? Explain how will this temperature affects the efficiency of this reaction. Why is Hot Start PCR technique preferred by some researchers? If the primers you purchased possessed the following information. 5'-GGA AAC AGC TAT GAC CAT G-3' Calculate the melting temperature of this primer and estimate the annealing temperature of this primer.Each of the following pairs of primers has a problem with it. Tell why the primers would not work well. (a) Forward primer 5'GCCTCCGGAGACCCATTGG 3' Reverse primer 5'TTCTAAGAAACTGTTAAGG 3' (b) Forward primer 5'GGGGCCCCTCACTCGGGGCCCC 3'Reverse primer 5'TCGGCGGCCGTGGCCGAGGCAG 3' (c) Forward primer 5'TCGAATTGCCAATGAAGGTCCG 3'Reverse primer 5'CGGACCTTCATTGGCAATTCGA 3'