If the recognition sequence of the restriction enzyme Hindlll is AAGCTT, then how many covalent bonds will be broken by the enzyme in the following DNA molecule? 5-T-C-A-A-G-C-T–T-C-G-A-A-G-C-T–T-G-A-3 3-A-G-T–T-C-G-A-A-G-C-T–T-C-G-A-A-C-T–5 O A. 1 O B. 2 OC.3 O D.4
Q: G C T A T A A T G G C A a a a t t g G G T C A G G C A a a t c g a C A T A G C T G A C G G g g a t g…
A: Dna is read in 5 ' to 3 ' direction and the mrna is read by the trna in the form of genetic code by…
Q: A piece of DNA fragment is sequenced. You clone the the fragment, isolate the cloned DNA fragment,…
A: While deciphering a sequencing gel, we know that it depends on terminating the reaction at 3' end…
Q: Given the sequence shown below, write the complementary DNA sequence, using the base-pairing rules,…
A: DNA (Deoxyribonucleic acid) and RNA (Ribonucleic acid) are two examples of nucleic acids. DNA and…
Q: The DNA sequence you use will be the following: T - A - G - C - C - A. You will need to make the…
A: chargaff's rule states that in DNA sequence in complementary strands the Adenine will form a bond…
Q: The Universal Genetic Code Table can be used to determine the gene product of a given nucleotide…
A: mRNA consist of mononucleotide sequence that specifies amino acids sequence in peptide chain. One…
Q: Given the following mismatch (highlighted in red), which base will be replaced after mismatch repair…
A: Normal metabolic activities and environmental exposure can cause DNA damage. DNA damage in human…
Q: What would the amino acid sequence be for the following DNA Transcript?…
A: DNA is the molecule that stores the information for the coding of the protein sequences in the human…
Q: A researcher wants to cut this piece of linear DNA. 5 AGCTAGTCCGGATCCGAGGGCCCTTCTCATGAGATCCGGATGACC…
A: The discovery of restriction enzymes in 1968 by Swiss scientist "Werner Arber" ushered in the era of…
Q: #4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’…
A: A restriction enzyme is a type of enzyme which cleaves DNA into fragments at a specific recognition…
Q: What would be a primer sequence synthesized from the following DNA sequence: 5'-ACGTG-3'? out of…
A: DNA polymerase cannot start DNA replication on its own. They require short double stranded region to…
Q: The partial sequence of one strand of a double-stranded DNA molecule is…
A: Restriction endonucleases are the enzymes used in genetic engineering or DNA cloning in which…
Q: a. Write the template DNA (complementary strand) sequence for the wild type gene above b. Write…
A: The coding strand is complementary to the template strand. The template strand is the DNA sequence…
Q: Draw the following strands of DNA 5’ C-A-T 3’ as well as the complementary base pairing strand…
A: Two strands of DNA twist around one another to form a double helix DNA and both are in anti-parallel…
Q: sing the genetic code provided what would be the corresponding polypeptide sequence for the DNA…
A: The DNA is transcribed into the RNA by the process of transcription and the RNA is translated into…
Q: In a standard procedire, when writing and reading base sequences for nucleic acids (both DNA and…
A:
Q: What is the nucleotide sequence of the complementary strand of the DNA molecule:…
A: Nucleic acids are large macromolecules that store hereditary information for cellular growth and…
Q: Reading from left to right, what is the nucleotide sequence on the other strand of DNA in this…
A: Answer :- D) G-G-C-A-T-A-T-G-T-A Double-stranded DNA takes the form of a helix, sort of a ladder…
Q: Show the expected labeled cleavage products if the following DNA segment were subjected to each of…
A: D.N.A. Cleavage --- A cleavage of single - stranded DNA oligonucleotides in the presence of ionic…
Q: Whatis the purpose of the dideoxynucleotides in DNA sequencing? OCH2 base - OCH2 base H. H. H. H. H.…
A: ddNTP(dideoxynucleotide triphosphate) used in sanger dna sequencing .which terminate the…
Q: What is the conformation of the glycosidic bond (i.e. orientation of the nucleobase relative to the…
A: All living organisms are made up of cells, which are the most basic unit of life. They are…
Q: 5'G-A-T-A-C-А-А-с-А-т-G-G-A-с-A-T-G-A-с-т3' What would be the first 3 bases in the 5' end of the…
A: In DNA four types of nitrogenous bases are found in which adenine (A) is complementary with the…
Q: Each of the following pairs of primers has a problem with it. Tell why the primers would not work…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: From the following DNA template, which sequence is synthesized by RNA Polymerase? 5’- T – C – C…
A: According to the central dogma of molecular biology, the information stored in DNA is first…
Q: Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using…
A: First a coding strand forms its complementary template strand during replication. Then m RNA is…
Q: Below are several DNA sequences that are mutated compared with the wild-type sequence. Each is a…
A: Note - Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: A partial amino acid sequence from the tick anti-coagulant protein is:…
A: The genetic code is a set of three-letter combinations of nucleotides called codons that corresponds…
Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…
A: Introduction : Transcription is the process in which a DNA sequence is transcribed into an RNA…
Q: lence: -T -G FG -A If RNA primase used this section of DNA to make a primer, what would be the…
A: RNA primase is an enzyme used in DNA replication. It produces RNA primer.
Q: The Sanger products in the sequencing of a template DNA is shown below: +ddTTP +ddATP +ddCTP +ddGTP…
A: Sanger method of DNA sequencing is a chain termination method of DNA sequencing in which…
Q: Hhal is a 4-cutter restriction enzyme that creates 2-base, 3' overhangs ("sticky ends") and…
A: Restriction enzymes can cleave the DNA sequences at the recognition sites, also known as restriction…
Q: What is the base sequence, specified in the 5′-to-3′ direction, for a segment of newly formed DNA if…
A: DNA (Deoxyribonucleic Acid) It is defined as a genetic material that has all the stored genetic…
Q: The following is the base sequence of DNA that codes for amino acids 506-510 of the protein that…
A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and…
Q: he enzymes BamH I and Bal II recognise different sequences but leave the same sticky ends: BamH…
A: An enzyme that recognizes a specific sequence on the DNA strand and cuts the DNA into fragments is…
Q: The following sequences of DNA would be synthesized using 5′-CAGTTCGGA-3′ as a template: *…
A: DNA is synthesized in 5' to 3' direction.
Q: Below is a sequence of DNA.…
A: Amino acids are the building blocks of proteins. The building blocks of life are amino acids and…
Q: A DNA synthesizer “machine” is used to create short single stranded DNA of any given sequence. You…
A: A Deoxyribonucleic acid (DNA) synthesizer machine used for generating shorter segments of DNA that…
Q: An original DNA sequence retrieved from the gametes of a female Golden Retriever and a mutated DNA…
A: DNA is two stranded structure , present bin double helix and is a genetic material in most of…
Q: Assume the sequence below is one half of a double stranded DNA template used in a PCR reaction. The…
A: Primers are short sequences of single stranded polymer that mark each ends of the target sequence. 2…
Q: TRUE OR FALSE a) The 2 chains composing one double helix run in opposite directions; they are…
A: All living organisms are made up of cells, which are the most basic unit of life. They are…
Q: What is the central theme of molecular genetics? Now let's look at the entire process of taking DNA…
A: As per our guidelines you are not allowed to answer more than three sab parts at a time please ask…
Q: sequence? Which enzyme will cut this sequence and where in the sequence? What is the sequence of the…
A: Given: Need to find the recognition sequence and sequence of the 'sticky end' produced by this…
Q: Does 5-bromouracil cause a transition or a transversion?
A: The transition mutation refers to a point mutation that replaces purine with another purine or…
Q: If you have got the following DNA templatemolecules, which one of them will require more energy to…
A: The separation of two antiparallel strands of DNA is dependent on GC content of DNA. G is guanine…
Q: A single strand of DNA, 24 nucleotides long, with the sequence 5'-TTTCCCgggAAAgggTTTAAAggg-3' is…
A: The given ssDNA would serve as a template strand for the synthesis of a complementary strand to form…
Q: What is the consensus sequence of these three DNA sequences? 5' - G G T G C A C - 3' 5' - A A T T C…
A: Gene is the primary unit of heredity of human life. It is found in the nucleus. It is transferable…
Q: The restriction enzyme Haelll has the recognition sequence below and cuts between the G and bases.…
A: restriction enzymes are the specific endonucleases that have a specific site within the DNA sequence…
Q: If the template DNA sequence is 3' - CCC - ATA - GAG - AAA - 5' , then what is the corresponding…
A: DNA is molecule which is present inside a cell and contain the genetic information of an individual…
Q: If you have got the following DNA template molecules, which one of them will require more energy to…
A: DNA is made out of four unique sorts of nucleotides, in particular, adenine, thymine, cytosine, and…
Q: 3 HaelII --- 5’ CC ↓ GG 3’ 5’ ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3’ 3’…
A: A restriction enzyme is a type of enzyme which cleaves DNA into fragments at a specific recognition…
Q: A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following…
A: When referring to DNA transcription, the coding strand is the DNA strand whose base sequence…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Strand 1: C-G-T-A-T-C-T-C-A-T-A-G-C-TStrand 2 : A-A-A-G-A-T-A-T-C-A-C-C-C-AStrand 3 : T-A-G-C-C-C-T-G-G-T-C-T-T-TStrand 4 : A-C-C-G-G-C-T-C-G-A-C-T-T-C How to Fill Out This Chart: Write the number of the strand you are using in the first column, and then write out thenucleotides from the strand of DNA you picked in the boxes moving down the chart. Now, line up the first three nucleotides of the DNA strand with the first three spaces for mRNA.Write the matching nucleotide on the mRNA strand. (Remember to use Uracil).**Leave the short ones blank, that’s just to show you codons. Once you have your mRNA completed, fill out the mRNA column. You have now transcribed the strand of DNA to mRNA, which can now leave the nucleus. Remember acodon is a sequence of three nucleotides. Draw a box around all the codons (or three in a row). These areimportant for looking at how that information is translated into amino acids or Translation. Think of it asthe language of nucleotides is being…Consider the following DNA sequence: -T -- -- If RNA primase used this section of DNA to make a primer, what would be the correct sequence of base pairs (from top to bottom)? T-A-C-C-G-T-T OT-U-C-C-G-U-U OA-T-G-G-C-A-A U-A-C-C-G-U-UA segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: G G C T A G C T G C T T C C T T G G G G A C C G A T C G A C G A A G G A A C C C C T Template strand with its polarity: 3’ C C G A T C G A C G A A G G A A C C C C T 5’ - Coding strand with its polarity: 3’ G G C T A G C T G C T T C C T T G G G G A 5’ Please write out the mRNA sequence generated by the template strand to produce that polypeptide chain.
- Which of the following sequences is less favorable to find in a folded beta? Select one: a.I-V-A-I-G-P-L-A-V-F-Y b. G-A-L-V-F-C-V-I-L-L-P c. E-V-A-I-I-F-M-D-G-V-A d. A-V-G-I-L-P-L-A-V-F-Y e.A-A-V-L-L-A-I-G-L-M-WMolnupiravir causes widespread mutations as SARS-CoV-2 replicates its genome because in an RNA double helix molnupiravir can base pair with more than one base. Shown below are the structures the RNA bases. With which two bases does molnupiravir pair? H N-H Adenine NH-N Uracil H H-N N-HN N-H Guanine H Cytosine A. The "imino" form pairs with A; the "amino" form pairs with G. B. The "imino" form pairs with G; the "amino" form pairs with A. C. The "imino" form pairs with U; the "amino" form pairs with C. D. The "imino" form pairs with C, the "amino" form pairs with U.Reading from left to right, what is the nucleotide sequence on the other strand of DNA in this section? C-C-G-T-A-T-A-C-A-T* A. C-C-G-T-A-T-A-C-A-T B. T-A-C-A-T-A-T-G-C-C C. A-A-T-G-C-G-C-A-C-G D. G-G-C-A-T-A-T-G-T-A
- The following segment of DNA codes for a protein. The uppercase letters represent exons. The lowercase letters represent introns. The lower strand is the template strand. Indicate the 3’ and 5’ ends of both strands. G C T A T A A T G G C A a a a t t g G G T C A G G C A a a t c g a C A T A G C T G A C G G g g a t g a G G T T A A C G A T A T T A C C G T t t t a a c C C A G T C C G T t t a g c t G T A T C G A C T G C C c c t a c t C C A A T T 2.Write the pre-mRNA molecule. Indicate the 3’ and 5’ ends. 3. Write the mRNA molecule. Indicate the 3’ and 5’ ends 4. Write the tRNA anticodons corresponding to the codons in the mRNA. 5. Write the sequence of amino acids in the resulting polypeptide.Permutation is the ordered arrangement of m number items out of a list of n items. For instance, the DNA strand with sequence of 3 bases: G-A-C IS different w ith A-G-C, C-A-G, G-C-A, A-C-G, and C-G-A. From this, we have: P-3) 3! 3x2x1 Therefore, there are 6 dıfferent sequences of DNA strands that can be formed out of 3 given bases. In general, we have this formula for permutation: (n-m)! Count the number of ways in which: Guanıne, Adenine, Cytosine, Thymıne, Cytosine, and Guanıne (6 bases) be sequenced in one DNA strand?What is the sequence of bases in the strand of DNA that is complementary to the one shown below?5'-T-T-C-A-C-T-G-A-C-3' Select one: A. 3'-T-T-C-A-C-T-G-A-C-5' B. 5'-A-A-G-T-G-A-C-T-G-3' C. 5'-G-T-C-A-G-T-G-A-A-3' D. 3'-U-U-C-A-C-U-G-A-C-5' E. 5'-T-T-C-A-C-T-G-A-C-3'
- From the following DNA template, which sequence is synthesized by RNA Polymerase? 5’- T – C – C – T – A – A – G – A –3’ Group of answer choices 5’- A – G – G – A – T – T – C – T –3’ 5’- U – C – C – U – A – A – G – A –3’ 3’- A – G – G – A – U – U – C – U –5’ 3’- T – C – C – T – A – A – G – A –5’ 3’- T – G – G – A – T – T – C – T –5’Which of the following DNAs is most likely to contain the recognition sequence for a homodimeric DNA binding protein? (Note that only one strand of the DNA is shown - you will find it helpful to write down the sequence and the sequence of the opposite strand to answer this question.) a) 5’- G A G C G A T C G C T C - 3’ b) 5’- G A G C G A G A G C G A - 3’ c) 5’- G A G C G A A G C G A G - 3’What is the term applied to the trinucleotide shown by the arrow? 5' Py U AU AGGCC G C G ACCACCUGe