The Universal Genetic Code Table can be used to determine the gene product of a given nucleotide sequence. Universal Genetic Code Table Second Letter A G UUU } Phe UCU UAU } Tyr UGU } Cys UUC UCC UAC UGC Ser UUA } Leu UCA UAA STOP UGA STOP UUG UCG UAG STOP UGG Trp CUU CAU CCU CCC CGU } His CUC CAC CGC Leu Pro Arg CUA ССА CAA CGA } Gin CUG CCG CAG CGG AGU } Ser AUU ACU AAU } Asn AAC AGC AUC A AUA Ile ACC Thr ACA AAA AGA } Lys } Arg AUG Met ACG АAG AGG GUU GCU GAU GGU } Asp GUC GCC GAC GGC Val Ala Gly GUA GCA GAA GGA } Glu GAG GUG GCG GGG The table below represents the transcription of a short peptide sequence in a human cell. Place the amino acid abbreviations that correspond to the nucleotide sequence when it is translated. DNA TTG CTG TGT GAG GCA MRNA AAC GAC ACA CUC CGU Protein (реptide sequence) :: Ala :: Arg : Asp :: Asn :: Сys : Gln : Glu : Gly :: His : lle : Leu : Lys : Met : Phe :: Pro :: Ser :: Thr : Trp : Val Third Letter First Letter

Q: The following sequence represents the dsDNA code for a short peptide 5' -CTT TCC CAT CAC CGC ATG…

A: 3= No , it is not possible for codon to code for another amino acid . 4= UAA is a stop codon , if…

Q: UUU UUC UUA UCU) UCC UÇA UCG UAU Tyr UACS Phe UGU U Ser UGC Cys UUG Leu UAA Stop UGA Stop A UAG Stop…

A:

Q: Consider the following chart: What type of mutation is this? DNA: TAC GCA TGG AAT MRNA: AUG CGU ACC…

A: By the translation process polypeptide chain is being synthesized from the mRNA sequence by the help…

Q: Given the following genomic sequence which contains 2 exons and CDNA sequence predict the amino acid…

A: The introns are the non-coding parts of the premature mRNA that must be removed by…

Q: Which of the following terms is used for the various forms of any one a) Autosomes b ) Codons c)…

A: Genes have a variety of different forms which are located at the same position or can be called…

Q: Examine Table 15-2. The codon AUG codes for the amino acid methionine and also for “start.” What…

A: The genetic code allows DNA and RNA sequences to be decoded into the amino acids of the protein…

Q: An mRNA transcript has the following complete sequence: 5'-AUGCCUACGUUACGGACC-3' Rewrite the…

A: Missense Mutation:  A missense mutation is a point mutation that results in a codon that codes for a…

Q: Transcriplioh nie For cuch of the following sequences, fill in either the DNA, the mRNA sequence,…

A: Synthesis of m RNA Sandhya and RNA transcription and synthesis of amino acids linked together by…

Q: 1. The below strand is a normal polypeptide. Using the below base sequence and amino acids, draw an…

A: AMINO ACIDS --These are the organic molecules ,structural which make up the proteins .The proteins…

Q: RNA sequence of A gene       If we have the following mutations, find the type of the mutation…

A:

Q: Which of the following represents the sequence of an RNA transcript for which the template strand of…

A: The deoxyribonucleic acid (DNA) is the nucleotide sequence that stores the genetic information of an…

Q: m

A: DNA → RNA RNA → protein

Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…

A: The central dogma is DNA --> mRNA --> Protein. Hence, any mutations in the DNA lead to changes…

Q: What would the amino acid sequence be for the following DNA Transcript?…

A: DNA is the molecule that stores the information for the coding of the protein sequences in the human…

Q: If a point substitution mutation changes the sequence 5'ATGAAA3' to 5'ACGAAA3' in the MIDDLE of the…

A: Point mutation is a genetic mutation in which a single nucleotide base is altered, inserted or…

Q: The coding strand of a mutant gene A allele is shown below. On the space provided, type the…

A: The translated product of mutant gene will contain the amino acid synthesized from the transcribed…

Q: Met – Asn – Cys – Phe – Glu – Met – Leu – Arg – Ile – Asp – Glu – Gly – Leu – Arg – Leu – Lys – Ile…

A: The central dogma of molecular biology states that it is the unique nucleotide sequence in DNA which…

Q: True or False Degeneracy of Genetic Code: 1. a given amino acid has more than one codon 2. the…

A: True or False Degeneracy of Genetic Code: 1. a given amino acid has more than one codon 2. the…

Q: Which one of the following options would be a good way to identify the location of the poly A tail…

A: Pre mRNA undergoes several post-transcriptional modifications. One of these modifications is…

Q: codons that specify the amino acid Vavne (Val), demonstrating the enet There are Second letter 1U C.…

A: There are 4  codons that specify the amino acid valine, demonstrating the genetic code  is…

Q: he question with gene sequence to predict amino acid sequence.

A: introduction  Translation is the process of translating the sequence of a messenger RNA (mRNA)…

Q: The following DNA sequence is derived from the middle of an exon of a eukaryotic gene. This sequence…

A: The Central Dogma concept states that DNA is duplicated into DNA. RNA is formed from DNA and…

Q: CUGACUGACUGA A template strand of DNA in a gene reads: TGG CTG GGT GCT ACA. GUCAGUCAGUCA Using the…

A: Firstly DNA template strand undergoes transcription process to form RNA. After that translation…

Q: The following is the DNA sequence of the entire protein-coding region for some small gene in a…

A: The flow of information from DNA to RNA is known as Transcription. (a) Transcription: It is a…

Q: For the below sequence, where the +1 site is in bold underline and the +10 and -10 sites are also…

A: Option 1 i.e. 5' AUA 3' is the correct answer.

Q: a) The following nucleotide sequence is found on the template strand of DNA: 3' - TAC TGG CCG TTA…

A: We are answering four parts  For rest of parts pls repost.

Q: When researchers obtain genomic sequence data from organisms with little known genetic information,…

A: The central dogma of life includes the following processes: Replication: In this process, the DNA…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: List all single base substitutions that would change a codon for Leu to a nonsense codon. For each,…

A: Mutation: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to…

Q: Why is it important that the correct reading frame is used?

A: DNA contains both coding and non-coding region where introns are non-coding regions and exons are…

Q: Given this sequence: AUG TAT ACC GAG, which of the following would result in a frameshift mutation?…

A: The sudden, inheritable, and stable alteration in the genetic material is said to be a MUTATION. The…

Q: Consider the following sequence of DNA: 3' - TACATGIIGTAG-5' a) Create a nonsense mutation with the…

A: DNA contains the genetic information for the physical characteristics of the human body. The DNA…

Q: These are portions of the coding strands of DNA for Wild-Type Hemoglobin and the mutated hemoglobin…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: A partial amino acid sequence from the tick anti-coagulant protein is:…

A: The genetic code is a set of three-letter combinations of nucleotides called codons that corresponds…

Q: The following is the DNA sequence of the entire protein-coding region for some small gene in a…

A: Mutations in the DNA molecule are caused by a spontaneous alteration. After a synonym mutation, the…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: The amino acids are coded by the group of three bases called base triplets and codons.

Q: The following is the base sequence of DNA that codes for amino acids 506-510 of the protein that…

A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and…

Q: plz explain with thorough explanation

A: Introduction : The physical appearance of an organism such as colour, height, which occurs as a…

Q: You are a researcher studying a gene you think is responsible for super human strength. You call the…

A: The two primers that is the forward primer and the reverse primer gets attached to different ends of…

Q: In the table below, there are four versions of gene A, one of which is normal, and the other three…

A: Mutations are sudden heritable changes that change gene expression. These changes in gene expression…

Q: Use the first picture and codon table to answer the following questions.

A: The exons are the coding portions of the gene and introns are the non-coding portions, which need to…

Q: 5' ACTGAGGATTCGGACAGCAATAGGATG 3' The -2 reading frame of the sequence above gives the following…

A: Answer. A genetic code is a triplet code called a codon. A given amino acid can be specified by more…

Q: A template strand of DNA in a gene reads: CCA AGC TCT. Using the codon chart provided, what is the…

A: Translation:  Translation is the process by which ribosomes in the cytoplasm or endoplasmic…

Q: Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…

A: Untranslated regions are present in RNA which are transcribed but not translated on either end of…

Q: A small section of bacterial mRNA has the following nucleotide sequence: GAC CCG AUG AAC The tRNA…

A: Translation  It is the synthesis of proteins from the codons present in the mRNA. Anticodons…

Q: 1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA? a. UUAGCCGACCCUAAU…

A: DNA replication is a proces by which molecule of DNA is duplicated. DNA replication is necessary to…

Q: please only answer part d and e

A: Cystic fibrosis is an autosomal recessive disorder, which affects lungs, digestive system and other…

Q: THE CODON TABLE FIRST POSITION SECOND POSITION THIRD POSITION TT UU UCU UAU UGU Phenylalanine…

A: Mutations are alterations in the genetic sequence. These alterations can be small or big. The…

Q: Use the codon chart to translate the following MRNA transcript into a protein. Please format your…

A: The synthesis of proteins with the help of  m RNA is know as translation.

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.