A high KM will result in an efficient enzyme. A. True B. False Specificity constant = Kcat/ KM kcat = Vmax [ET] A high Vmax will result in an efficient enzyme. A. True B. False Total enzyme concentration will have no effect on the efficiency of an enzyme catalysed reaction. A. True B. False
Q: (Biochemistry, Topics: Glycolysis and Citric Acid Cycle) - What carbon atom in glucose leads to the…
A: The carbon atom in glucose that is connected to the carboxylate carbon in succinate is referred to…
Q: Parts of the mechanism for lysozyme are shown below. The catalytic lysozyme residue side chains can…
A: Lysozymes cleave the glycosidic bond between N-acetylmuramic acid (Mur2Ac) and N-acetylglucosamine…
Q: For the following reaction: HNO3 H2SO4 NO2 NO2 NO2 10% 8% 82% 1. Write a reasonable mechanism, using…
A: 1) isopropyl benzene is considered to be electron donating by positive inductive effect of its…
Q: Explain the concept of protein folding and its importance in determining protein structure and…
A: The objective of this question is to understand the concept of protein folding and its significance…
Q: Question 10
A: The objective of the question is to identify the type of primers used for DNA replication in living…
Q: Consider the following Peptide: Alanine-Lysine-Glutamine-Serine-Glycine Select all that applies Give…
A: Peptides are short chain of amino acids linked by peptide bonds. Amino acids that have been…
Q: What is the final reaction in the final round of fatty acid synthase? Acetyl-CoA ACP Transacylase…
A: The question is asking about the final reaction in the process of fatty acid synthesis. Fatty acid…
Q: The molecule shown below is a monomer of ________. We know this because of the structure of the…
A: The correct answer is: b) DNA; B Explanation: Explanation:The molecule shown in the structure…
Q: 3. In your textbook the termi- nal enzyme catalyzing the ter- minal step of glycolysis is known as…
A: Approach to solving the question: Detailed explanation:This contains information related to the…
Q: 11. List 2 polysaccharides that provide structure and strength. What is interesting about the…
A: The objective of the question is to identify two polysaccharides that contribute to structure and…
Q: Genomic imprinting refers to the inheritance of: Question 16 options: Gamete…
A: The correct answer is:Gamete specific DNA methylating marks during meiosis.Genomic imprinting refers…
Q: Hypoglycin A, an amino acid derivative found in unripened lychee, is an acutely toxic compound that…
A: There are 20 different amino acids that exist in nature. They are involved in forming the protein…
Q: compound. (2 pts) 8: Migratory birds in the weeks preceding their long flights often consume a…
A: The objective of the question is to understand why migratory birds consume a fat-rich diet before…
Q: You have a crude lysate sample (CL) containing a mixture of six proteins (1, 2, 3, 4, 5, ẞ-…
A: Proteins precipitate at specific concentrations of various salts. The concentration of salt required…
Q: The following table provides data on three popular protein supplements. (Figures shown correspond to…
A: Let the number of servings of designer whey be 'x' and the number of servings of muscle milk be…
Q: 2. Compare and contrast the biological roles of the following amino acids the following pairs of…
A: The objective of this question is to compare and contrast the biological roles of three pairs of…
Q: I need answer expert solutions please
A: Certainly! Let's break it down:1. Composition: The disaccharide consists of two glucose molecules…
Q: 250 150 2 -250 150 100 -100 75 -75 50 -50 37- 37 25 20 15 10 Std Calf Fibrinogen BSA Std Biorad…
A:
Q: A student performed an enzyme inhibition reaction to experimentally determine the inhibitor constant…
A: The Dixon plot is a graphical method used in enzyme kinetics to determine the inhibition constant of…
Q: Deficiencies of carnitine, carnitine acyltransferases, or carnitine/acylcarnitine translocase affect…
A: CPT I deficiency is when long-chain fatty acids remain attached to carnitine in the matrix because…
Q: Mechanism
A: Step 1: To solve the chemical reaction depicted in the image, you would need to apply knowledge of…
Q: The oxyanion hole of a serine protease has which of the following roles (select all correct…
A: The objective of the question is to identify the roles of the oxyanion hole in a serine protease.…
Q: Draw the reaction between sphingosine and arachidonic acid and draw the full structures
A: Sphigosine is the platform molecule of sphingolipids. Arachindonic acid is a 20 carbon fatty acid…
Q: Which of the following processes is dependent on the activity of pentose phosphate shunt?…
A: The pentose phosphate pathway, or the pentose phosphate shunt, plays a crucial role in several…
Q: Find the structure of insulin online.Draw the tripeptide at the beginning of the Chain A and the…
A: Insulin is a peptide hormone composed of two polypeptide chains, usually referred to as Chain A and…
Q: using sample prep aka the protocol use it to fill in the tables
A: Explanation: Lysozyme (mL): The amount of lysozyme diluted and added to each conical tube. The…
Q: 1. Draw the Fisher projection of D-glucose, and from Fisher to Haworth projection of ẞ-D-glucose.…
A: The configurations of the D-glucose are: R , S , R , RIn β−D−glucose C1 -OH is present on the up…
Q: Knowing that liquid liquid phase separation will occur when the change of gibbs free energy of the…
A: Inducing Liquid-Liquid Phase Separation (LLPS) in Cells-Liquid-liquid phase separation (LLPS) relies…
Q: (Biochemistry Topics: Glycolysis and Citric Acid Cycle) - Which of the following molecules can…
A: Gluconeogenesis refers to the process of production of glucose from non-carbohydrate sources.…
Q: Geraniol OH Squalene Farnesol OH
A:
Q: 3. What is the major organic product obtained from the following reaction? CH3 S CH COCI AIC b COCH3…
A: Step 1:It is an example of fridel-craft acylation reaction. Mechanism followed in this reaction is…
Q: None
A:
Q: Give 2 similarities and 2 differences between transcription and replication
A: Transcription and replication are vital processes explained in the central dogma of molecular…
Q: B-oxidation deals with only saturated fatty acids, but many fatty acids in natural lipids are…
A: Beta oxidation is a metabolic process in which the two carbon atoms are sequentially removed from…
Q: QUESTION 2 10 11 12 Glucose Pyruvic acid 2 ATP Lactic acid 13 36 ADP 36P 36 ATP Match the FOLLOWING:…
A: Answered the question.
Q: O 2 ← 3 - Which diene can be used to prepare the following product by alkene metathesis? ہو ہو
A: To find the correct diene for the product, we need to consider the structure of the product and work…
Q: What is the IUPAC name of the following compound?
A:
Q: Question 7
A: The objective of this question is to determine how many of the bacterial cells will be radioactive…
Q: Select all that applies
A: ATP plays a crucial role in regulating the activity of phosphofructokinase-1 (PFK-1), an enzyme…
Q: The authors in the abstract given above describe the mechanism for the activation of metallothionein…
A: Protein Phosphatase 2A (PP2A) Binding: Complexes of PP2A PR110 bind to MTF-1, the metal regulating…
Q: 5. Draw head group structures and name the following glycerophospholipid. a: Glycerophospholipid…
A: ### a: Glycerophospholipid that carries a net positive charge at pH 2.5.At a low pH such as 2.5, we…
Q: What is the net yield of ATP when 2 molecules of pyruvate are completely oxidized? (enter numerical…
A: Detailed explanation:In aerobic respiration, the full oxidation of two molecules of pyruvate…
Q: Consider a cell that requires much more ribose5-phosphate than NADPH. The cell needs ribose…
A: The question is asking about the metabolic fate of glucose 6-phosphate, glycolytic intermediates,…
Q: Given the line-weaver Burke plot below for Enzyme Y, identify the Vmax for Enzyme Y. -10 30 1/v…
A: 0.056Explanation:To find the Vmax from a Lineweaver-Burk plot, we need to take the reciprocal of…
Q: What is the mRNA transcribed by the following piece of DNA? Make sure to label its directionality.…
A: To determine the mRNA transcribed from the given DNA sequence, We need to identify the complementary…
Q: Which of the following statements accurately describes differences in beta oxidation vs fatty acid…
A: The objective of the question is to identify the accurate statements that describe the differences…
Q: 5'-AATGCCTCAGCCGATCTGCCTCGAGTCAATCGA TGCTGGTAACTTGGGGTATAAAGCTTACCCATGGTATCGTAG…
A: PCR is a lab technique used for amplification of target DNA sequence by using a thermostable DNA…
Q: Question 9
A: The question is asking us to identify the enzyme that is responsible for separating DNA strands…
Q: I need help filling in the boxes
A:
Q: If the following polysaccharide were to attach to a protein, to which atom(s) in the carbohydrate…
A: A glycosidic bond is a type of covalent bond formed between the anomeric carbon of the carbohydrate…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Which of the following statements about the Michaelis Menten constant (Km) is correct......A. can be determined by plotting the data v/[S] against 1/[S] B. A large Km indicates a low affinity between the enzyme and the substrate C. A large Km means that a large concentration of substrate is needed for the enzyme to work D. is a measure of the affinity of enzymes for proteins, minerals and vitamins E. Small Km means that a large concentration of substrate is needed for the enzyme to work1. Make a Lineweaver-Burk plot and use the plot to complete the information in the table and the following questions. a. Is it possible for the enzyme to overcome the effect of the inhibitor in question from the chart. Explain. b. What prevents this enzyme from being an even more catalytically efficient enzyme? c. What do single molecule data indicate about the validity of ensemble data?d. What is the reason that humans are insensitive to sulfa drugs?Explain as brief and simple as possible. Answers must not be more than 30 WORDS each. a. All coenzymes are cofactors, but not all cofactors are coenzymes. Explain this statement. b. How does the induced-fit model of enzyme action explain the broad specificities of some enzymes? c. In competitive inhibition, can both the inhibitor and the substrate bind to an enzyme at the same time? Explain your answer d. Why is penicillin toxic to bacteria but not to higher organisms? e. What is the metabolic basis for the observation that many adults cannot ingest large quantities of milk without developing gastric difficulties?
- Explain as brief and simple as possible. Answers must not be more than 30 WORDS each. a. How does the induced-fit model of enzyme action explain the broad specificities of some enzymes? b. In competitive inhibition, can both the inhibitor and the substrate bind to an enzyme at the same time? Explain your answer c. Why is penicillin toxic to bacteria but not to higher organisms?Use the relationships revealed by a Lineweaver-Burk plot and the table of enzyme performance to calculate the Vmax and Km of the enzyme with no inhibitor. with inhibitor A, and with inhibitor B. [S] (uM) Vo (umol/min); w/ no inhib. Vo (umol/min); w/ inhib. A Vo (umol/min); w/ inhib. B 10 6.3 5.1 4.0 40 18.4 15.8 11.8 100 29.9 27.0 19.1 150 34.7 32.0 22.2 No inhib. Vmax= Km= Inhib. A Vmax= Km= Inhib. B Vmax= Km=Select all the true statements about sequential versus concerted models of allostery. a. In sequential allostery, binding of the substrate on one end of an enzyme causes a conformational change on the other end which propagates to another enzyme and enables easier binding of a second substrate to the second enzyme b. No conformational changes occur in either model c. In concerted allostery, the two forms of the enzyme exist in equilibrium because of a conformational change independent of substrate binding d. In concerted allostery, binding of the substrate to one of the forms is favorable (but not to the other) and binding of the second substrate is enhanced on the favorable form
- Consider the Michaelis-Menten enzymes below and answer the following questions. Kcat (s') 9.5*105 1.4*10* 2.5*102 1.0*107 5.0*10 8.0*10² Enzyme Km (M) A В a. Which enzyme has the highest affinity substrate? How do you know? b. Which enzyme can convert the most substrate to product in a given period of time? How do you know? c. Which enzyme has the highest catalytic efficiency? How do you know?Select all the true statements about sequential versus concerted models of allostery. Group of answer choices A. In sequential allostery, binding of the substrate on one end of an enzyme causes a conformational change on the other end which propagates to another enzyme and enables easier binding of a second substrate to the second enzyme B. No conformational changes occur in either model C. In concerted allostery, the two forms of the enzyme exist in equilibrium because of a conformational change independent of substrate binding D. In concerted allostery, binding of the substrate to one of the forms is favorable (but not to the other) and binding of the second substrate is enhanced on the favorable formPenícillin is an esxample of what type of enzyme inhíbitor? A. Competitive B. Noncompetitive C. Uncompetitive D. Irreveralble What type of Inhíbition ia observed from the ahift of the Lineweaver-Burke plot ahown in the graph below where the solid line represents the uninhibited enzymatic reaction while the broken line represents the inhibited enzymatic reaction? A. Irreveraible inhibition B. Noncompetitive inhibition C. Competitive inhíbition D. Uncompetitive inhibition Potaszium cyanide ia a polzon which combines with cytochrome A3 to prevent binding of oxygen to the enzyme without altering the Km of the reaction with reapect to reduced cytochrome c. Which type of inhíbition does this represent? 9. A. Irreveraible inhibition B. Noncompetitive inhibition C. Competitive inhibition D. Uncompetitive inhibition Which of the following enzyme clesses catalyze reactions in which two molecules become diasociated from each other? 10. A. Kinase В. Нydrolaae C. Isomerase D. Ligase 1. Which of the…
- Which of the following is true for the induced-fit model of enzyme-substrate binding? A. The conformation of the enzyme’s active site changes when the enzyme binds to its substrate B. Stronger interactions between the enzyme and its substrate are formed as compared to the lock-and-key model of enzyme-substrate binding C. Both A and B D. Neither A nor B Which statement does not apply to transition states? A. only exist transiently (have lifetimes on the order of 10^-14 to 10^-13 seconds) B. differ in energy from the substrate by the activation energy C. Chemical bonds are in the process of being formed and broken. D. Many have been detected and purified experimentally.Evaluate the following statements concerning enzyme kinetics. Which one of the statements is false? a. Enzyme saturation fluctuates. b. In an uninhibited enzymatic reaction system, adding an excess of substrate will increase the reaction velocity beyond Vmax. c. The Vmax of an enzyme kinetics graph represents the point at which the enzyme is saturated with substrate. d. Non-competitive inhibition of an enzymatic reaction can be overcome by adding more unaltered enzyme. e. The activation energy of a reaction can be reduced by the presence of an enzyme.What is a limitation of the Michaelis-Menten kinetics? A. Enzymes have different binding sites which were not considered by the Michaelis-Menten assumption. B. Most enzymes are multimeric with many active sites. C. Variability in enzyme concentration due to synthesis and degradation by cells were not included in the Michaelis- Menten assumption. D. Enzymes have coenzymes that are involved in catalysis. E. Active sites can bind multiple substrates.