Q: Discuss how the use of antimicrobial agents selects for resistant microbes and explain how…
A: Antibiotic and antifungal use puts pressure on bacteria and fungi to adapt, which speeds up the…
Q: The amount of sodium in Bowman's capsule can be doubled by: O A. Doubling of glomerular hydrostatic…
A: Introduction The Bowman's capsule, a component of the nephron, creates a sack that resembles a cup…
Q: The union of the male and female gametophyte in angiosperms and gymnosperms results in A seed,…
A: The name "angiosperm" comes from a Greek word that means "vessel." The angiosperm is essentially a…
Q: Match the following events with the stages in mitosis
A: Cell division is a metabolic phenomenon in takes place inside the living cell in which parent cell…
Q: What is the resultant ionic movement when stereocilia move towards the tallest kinocilium? Efflux of…
A: Introduction : Around the hair cells of the inner ear are two different kinds of fluid. The fluid…
Q: if you plant a munggo seen in a box with small amount of light entering it, what will be the…
A: Munggo is a mung bean, a small green legume commonly used in Southeast Asian cuisine. It can be…
Q: Use the following information to answer the next question. a. In Drosophila (fruit flies), a gene…
A: 1. Natural selection, gene flow, and other factors in a population can alter allele frequencies over…
Q: Explain 3 possible reasons why coral reefs are so diverse?
A: Despite taking up less than 1% of our oceans, coral reefs are one of the planet's most diverse…
Q: Which of these would be a first line of defense against microbial infection?
A: Ans : Our immune system has three lines of defense to fight against microbial infection. Those are :…
Q: Regarding STR markers used in forensic science. Tick all the correct statements: no correct…
A: Short tandem repeats (STRs), which make up around 3% of the human genome, are brief repeating DNA…
Q: Based on the data shown in the pie charts (from DiFilippo et al. 2010): Gut microbiome richness is…
A: Species diversity is the variety of species found within a region. Species diversity has two…
Q: Again, at the making of this exam, the following numbers represent people that have been infected…
A: Number of infected people in California- 819,782 people Oregon - 33,862 people Washington- 87,522…
Q: Your short answer should be 2-5 sentences depending on the question. (Ch. 53). Please answer both…
A: The growth curve is an important part of a population which indicates the stability and…
Q: An allergy can best be defined as ______. A) a component of the humoral response B) an exaggerated…
A: The function of the immune system is to protect from foreign substances. Hypersensitivity is a…
Q: What are "genetic biohackers" in reference to "do it yourself CRISPR kits"?
A: CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) is a gene-editing technology that…
Q: I know that Enterobacter Clocoae was supposed to test positive for the catalase test. My test…
A: Enterobacter Clocoae is gram negative bacteria, it is rod shape bacteria that has flagella all over…
Q: Give 4 similarities and 4 differences between nucleic acid synthesis and protein synthesis.
A: Nucleic acid is a macromolecule that consists of nucleotide monomers and carries genetic information…
Q: Explain the intracellular pathways) calcium channel blockers in regards tot he heart. Give…
A: A class of organic chemical compounds known as calcium-channel blockers has the ability to prevent…
Q: Prions
A: Prions: This term means proteinaceous infectious particles. These are virus like organisms which…
Q: The etiologic fraction refers to which of the following? Group of answer choices C. Fraction of…
A: The greatest estimate of the percentage of disease incidence that would be avoided if a particular…
Q: Explain why infections caused by fungi, protozoans, and helminths are more difficult to treat than…
A: Introduction : Infection is the entry of the pathogen or infectious agent that causes the disease…
Q: Did studying genetics help you change your perspective about what a human is
A: Genetics It refers to the study of genes and heredity. Heredity refers to the passing of genetic…
Q: In a population of 643 mice, 124 had white coat colour (a recessive trait) while the rest had black…
A: Random mating occurs when individuals in a population mate with other individuals in the population…
Q: Describe the methods you could have used to isolate the pathogenic organism from the initial stool…
A: A non-pathogenic organism is an organism that does not cause disease. Examples of non-pathogenic…
Q: Using evolution and primate behavior as a guide, explain how cooking is associated with human…
A: The chenge in the characteristics of species over a period of time is known as evolution.
Q: What is gene therapy? How can it be used to improve human health?
A: DNA is the genetic element in eukaryotes. The genes control the flow of information when expressed…
Q: If a virus particle contained double-stranded B-DNA of 400,000 base pairs, A. What would be the…
A: DNA, deoxyribonucleic acid is the hereditary material in found in humans and almost all living…
Q: which of the following is used to help make sure a metagenomic study has fully measured the…
A: Metagenomics is noteworthy since it may be utilized to examine assorted microorganisms found in…
Q: Please name any five characteristics of the human eye that contribute to its ability to capture…
A: The human eye is a sensory organ that responds to visible light and is a component of the sensory…
Q: State why there is no such thing as a Phylum Lichen.
A: Pioneer species are the first species that arrive after a disturbance, such as a flood, or when the…
Q: Identify the parts in these plant and animal cells. Human cheek cell, 400x Outermost layer Animal…
A: Image in left upper corner: As human cheek cell is an animal cell, the organelle that contains DNA…
Q: Determining age at death for sub-adults is achieved by looking at the degree of epiphyseal fusion in…
A: Fusion of different bones occurs at age (years): Humerus distal end : 13-16 Femur proximal end :…
Q: کو اتار کر کے TATAAA box Translation initiation codon Intron 1 Exon 2 Intron 2 A. 5' Capping defect…
A: The answer is option The answer is option (E). Protein truncation.
Q: How does adaptation of the hair cell response occur when the same frequency is sensed? Myosin holds…
A: Myosin is a type of motor protein that is found in muscle tissue. It is responsible for muscle…
Q: Describe the basic process of pattern formation in segmented animals. Please expain me indded with…
A: Segmented animals are those animals have repeated oragans and there body have composed of…
Q: Based on the haplotype network below, which statement is correct? a. None of the answers is correct…
A: A sort of genetic difference within humans can be called single nucleotide polymorphisms or SNPs.…
Q: Regarding the analysis of single marker STR results used in forensic science. Tick all the correct…
A: The true statements among the given statements are: If a suspect's alleles are different from those…
Q: Distance en left her house and drove to college in the morning, as shown in the ccompanying graph.…
A:
Q: Define what the “Theory of Mind” means and explain its importance to primate social behavior.
A: The ability to attribute mental states to oneself and others is referred to as theory of mind, and…
Q: Select the events from eukaryotic transcription from the list below and list them below in order, by…
A: What is transcription? Transcription is the process where RNA is synthesized from DNA by the…
Q: What hormones are involved in renal functions, and what 2 systems, ultimately what affects water…
A: The kidneys assist in maintaining the body's fluid balance by filtering the blood. Small tubules in…
Q: diagram modeling the pathway by which a nitrogen atom in a protein in a bird can become…
A: Introduction the formation of protein in plants by absorbing nitrogen from the animal and bird…
Q: a) Draw the diagram and describe motility required for the bacteria that have flagella to an…
A: "Bacteria are a diverse group of microscopic, unicellular organisms that are categorized as…
Q: our short answer should be 2-5 sentences depending on the question. (Ch. 50). Please answer both…
A: The several kinds of sensations that humans are capable of perceiving are used to guide our motor…
Q: Are cells grown in the laboratory will function similarly when transplanted?
A: The smallest component that makes up living organisms is called a cell. It is made up of the cell…
Q: List down 10 warm-up exercises for badminton. Specify by Name of exercise , counting, target…
A: Warm-up exercises can help to prepare the body for physical activity by increasing blood flow to the…
Q: Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what…
A: Introduction The process by which a gene's information is used to produce either RNA molecules that…
Q: What is a common feature of the voltage sensitive Ca++, Na+ and K+ ion channels? A single…
A: The structure of Na+, K+, and Ca2+ channels is made up of four transmembrane domains arranged around…
Q: Use the following information to answer the next question. The DNA strand shown below is thought to…
A: DNA ( deoxyribonucleic acid ) is two stranded , helical structure which act as genetic material in…
Q: VNTR markers: 0 ☐ 0 are usually detected by DNA sequencing are the first used by forensic services…
A: VNTRs (Variable number tandem repeats) also referred to as microsatellites or simple sequence length…
What is the grade of raw milk in Figure 8? Grade of pasteurized milk?
Step by step
Solved in 2 steps
- TRUE or FALSE only! 1. Pure cultures contain only a single species and no other organisms. 2. Pour plate method is done by pipetting liquified warm agar into a petri dish containing an inoculum. 3. Flaming the test tube’s mouth is necessary so that the moisture that accumulated will evaporate. 4. After Gram staining, the Gram positive bacteria will appear blue while the Gram negative bacteria will appear red.Idenitfy the statements whether they are TRUE or FALSE 1. You should use P-20 micropipettes to transfer volumes for spread plating. 2. You should use P-200 micropipettes to transfer volumes for pour plating.TRUE or FALSE only! 1. The most important step in doing a slide mount technique is fixing the sample with heat or chemicals. 2. Diluted samples from the serial dilution procedure are used for pour plating and spread plating methods which can be done simultaneously. 3. In doing aseptic techniques, it is practiced to touch the tip of the inoculating loop to test its coolness for transfer of cultures. 4. One of the important points to consider when calibrating an ocular micrometer is that its lines must properly superimpose with that of a stage microruler.
- ク94% P 9:12 docs.google.com a * ZAIN IQ Iı. component used as a solidifying. . -1 * agent for media إجابتك media are used when specimen . . -2 .cannot be cultured soon after collection إجابتك media which can be used for. . -3 * motility testing إجابتك staining used for Mycobacterium. .-5 tuberculiosis3. Fill in the values below (0.5) 1 ml Sample Tube dilution Final dilution 1 ml sample 1 ml 1 ml TEED 9 ml 9 ml diluent diluent Tube dilution Final dilution 50 μl Sample 4. Fill in the values below (0.5) 9 ml 50 μl sample diluent 100 μ. 50 μl 0000 100 μl 100 μl diluent diluent diluent 50 μl 1ml 50 με 9 ml diluent 100 μl diluentTRUE OR FALSE 1. The antheridium of a moss could be seen as a whole mount at 100x magnification. 2. The fine adjustment knob sharpens the image in all objectives. 3. While disinfecting the isolation room with UV light, stay inside so that your hands and clothes will also be sterilized.
- Procedure: 1. Prepare 5 test tubes. Place 1 ml of 1% starch and add 10 drops of saliva to each tube. Mix thoroughly. 2. Place the first tube in ice water, the 2nd tube leave at room temperature, the 3rd tube in 40°C , the 4th tube at 60°Cwater bath and the 5th tube boil for 2 minutes.. 3. Leave the 4 tubes in their respective temperatures for 30 minutes. The 4th tube allows to stand for 30 minutes after heating for 2 minutes. 4. Test the contents of each tube with iodine and benedict’s tests.1. Fill up the table below to summarize the confirmatory test for casein and whey. Test Sample Filtrate Residue / Precipitate Milk Component Reagents Observations Inferences 2. Test for Milk Fat Briefly describe how milk fat is being tested?Given Test Reagent Positive or Negative Result Reason/Explanation Ribose Bial’s Orcinol Test Maltose Benedict’s Test Milk Molisch Test Cellulose Iodine Test
- If the concentration of solutes in the fluid surrounding the cell is greater than the cell's cytoplasm then the surrounding fluid is to the cell cytoplasm. 00000 Endergonic Exergonic Hypertonic Isotonic HypotonicAnswer TRUE OR FALSE only. 1. All types or kinds of media powder has a standard ratio of 23:1000. Meaning that 1000 ml of water is needed to dissolve 23 grams of powder medium. 2. Simple stains use one dye and cannot differentiate various types of bacteria while differential stains use several dyes in order to differentiate between different kinds of bacteria. 3. A certain student prepared his fixed sample for examination by pouring Nigrosin which is an acidic stain. He then observed that under the microscope the background was stained but the bacterial cells were untouched. This student therefore adapted the acid-fast staining procedure. 4. In doing serial dilutions, the original sample must be shaken at least 25 times to obtain a uniform distribution of organisms. 5. Label all reagents with its name, concentration and date of its preparation except for water.Test Description Terminal Terminal Medium, Incubation Incubation Results temperature time (°C) electron enzyme reagent ассeptor 1 Oxidase test Tryptic 24 – 48 hours soy agar (TSA), QxiDrop 2 Catalase Охудen test N/A Nitrate 37 reductase N/A test