Like a helices, B sheets often have one side facing the surface of the protein and one side facing the interior, giving rise to an amphiphilic sheet with one hydrophobic surface and one hydrophilic surface. From the sequences listed below, pick the one that could form a strand in an amphiphilic ß sheet. O TLNISFQMELDV DSETKNAVFLIL VLEFMDIASVLD
Q: A TRNA molecule with the anticodon UGC would be carrying the amino acid: Second base of codon…
A: tRNA brings its amino acid to the mRNA in a specific order. This specific order can be determined by…
Q: Which of the following would be considered a severe mutation? A) Leucine (Leu) > Lysine (Lys) B)…
A: Amino acids are classified based on their properties like whether they are polar or nonpolar,…
Q: GCA UGC CGA UAC
A: 1. The tRNA anticodons for the amino acid sequence shown above is - GCA UGC CGA UAC
Q: includes
A: A new Covid, known as serious intense respiratory disorder Covid 2 (SARS-CoV-2), is the aetiological…
Q: Using the nucleotide sequence of an accession number (NM_019121) what is the translated amino acid…
A: Proteins are made up of amino acids. DNA is the genetic material that codes for the amino acids that…
Q: The difference between prokaryotic and eukaryotic protein initiation is that eukaryotes' initiator…
A: Translation is the process of Synthesis of proteins from amino acids by peptide bond formation. It…
Q: Write the consensus sequence for the following set of nucleotide sequences. AGGAGTT AGCTATT TGCAATA…
A: Genes are the structural and functional units of heredity. They carry coded genetic information in…
Q: threonine, alanine, and isoleucine. The TRNA anticodons for the amino acid sequence shown above is…
A: Protein synthesis or translation process takes place on the ribosomes with the help of messenger RNA…
Q: Three E. coli tRNA molecules with the anticodon sequences CGG, OGG , and UGG are charged with the…
A: During Protein synthesis or translation that occurs in ribosomes, messenger RNA code for an amino…
Q: a. Identify the type of mutation shown below. b. How many amino acids are affected? c. What type of…
A: Mutation - Mutation is defined as the sudden inheritable changes in the structure of the DNA or in…
Q: Consider the following 2 codons sequences. Codon sequence 1: ACU AGA GAU GUC UGC Codon sequence…
A: β-sheets are formed by adjacent parallel or antiparallel peptide strands that are hydrogen bonded in…
Q: Which of the following is not correct regarding protein domains or modules such as the…
A: Amino acids when combined with a peptide bond, they form proteins. Proteins are macromolecules made…
Q: Order of bases in DNA Order of bases in MRNA (codon) AUC Order of bases in tRNA TAG Amino acid coded…
A: Amino acids are the smallest monomers which are known to form the polypeptide sequence of the…
Q: Choose the correct protein sequence that would result from the following DNA template sequence using…
A: Central dogma is the central cellular process that helps in the conversion of the DNA to m RNA by…
Q: A small section of bacterial enzyme has the amino acid sequence threonine, valine, glycine, and…
A: The process of formation of amino acids from the mRNA sequence is known as translation. mRNA…
Q: The top side of this figure offers more opportunities (for each base pair) that can lead to highly…
A: A single stranded nucleic acid is formed by joining the nucleotide units together through…
Q: Which form of flavin adenine dinucleotide is the "reduced" form, FAD or FADH2? Explain
A: Flavin Adenine Dinucleotide: It is a redox active coenzyme associated with various proteins, which…
Q: Second letter UUU Phenyl- UUC alarine UGU UGC Cysteine UAU UCU UCC UCA UCG UAC yrosine Serine UUA…
A: Mutation of amino acids change the primary structure of the protein which affects the protein…
Q: If a tRNA has an anticodon sequence 5'-CAU-3', What would be an amino acid carried by that tRNA?
A: Codon is defined as the the group of three nucleotides that encode an amino acid.
Q: Which amino acid would be attached to a tRNA that read "GGU"? Val (M) Ala (A) Ser (S) 3'- Arg (R) A…
A: Amino acids are the structural unit of proteins, that is made up of carbon, hydrogen, Oxygen and…
Q: What is the net charge of the peptide at pH 7 that is synthesized from this DNA sequence? 5'…
A: As we know that the DNA sequence exhibits codons, which helps in the formation of mRNA, and then…
Q: An anticodon on a TRNA has the sequence 3' UAC 5. What amino acid would it be charged with?
A: The tRNA is the transfer ribonucleic acid and it helps to decode the information present in the mRNA…
Q: Consider the following polypeptide sequence: Gly Val Tyr Ile Val Asp His Phe Thr Gly Asn Tyr Ala Leu…
A: Trypsin breaks down proteins in the duodenum into smaller peptides. Other proteases would further…
Q: Find self-complementary regions in the following RNA sequence: AUGUGGCAUGCCAGG
A: Biomolecules includes carbohydrates, lipids, nucleic acids and proteins. Nucleic acid plays an…
Q: A polypeptide is digested with trypsin, and the resulting segments are sequenced: Val-Gly…
A: Trypsin and chymotrypsin are essential serine proteases that are secreted by the pancreas. They play…
Q: The change of one conformation of protein to another is called a. allosteric transversion b.…
A: Option b Allosteric transition
Q: A polypeptide is digested with trypsin, and the resulting segments are sequenced:…
A: Introduction: A number of enzymes catalyze the breakdown of peptide bonds at a specific site in an…
Q: For the following DNA bases, give the complementary mRNA code that would be transcribed from these…
A: The process of formation of m RNA with the help of DNA is called transcription. During the formation…
Q: Consider à ollowing sequence: His-Cys-Leu-lle-Met where Met is at the C-terminus end. Based on the…
A: Amino Acids are are structures linked by Peptide Bonds to Form Polypeptide Chains. Proteins are…
Q: If DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base…
A: The DNA sequence GCATAG will have the mRNA code CGUAUC. When the sequence changed to GCATGG, then…
Q: A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a…
A: Melting temperature is the point at which 50% of double-helical DNA is changed into a…
Q: Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3' O…
A: Answer :- Met-ala-phe-lys-stop DNA…
Q: For each of the proteins involved in DNA replication in E.coli that is shown, select the best…
A: Given, Primase Adds/subtracts supercoils and can remove the knots or loops in DNA DNA…
Q: Please determine the order of aminoacids from a given genetic code? 5’-UGGUACGGUACUCCAC-3’
A: Transcription is the process in which the information present on the DNA is transferred on to a…
Q: Refer to the codon diagram on. Which of the following is a codon that will terminate translation? *…
A: The process of formation of a polypeptide sequence from an mRNA transcript is known as translation.…
Q: For each of the following sequences, rank them in order (from best to worst) as sequences that could…
A: DNA is the genetic material that carries genetic information in the form of coded nucleotide…
Q: Polyglycine, a simple polypeptide, can form a helix with φ = -80°, ψ = +150°. From the Ramachandran…
A: A protein can arrange itself according to requirements. It can be primary, secondary, tertiary and…
Q: Use the first picture and codon table to answer the following questions.
A: The exons are the coding portions of the gene and introns are the non-coding portions, which need to…
Q: If a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "a" side in the…
A: Here in question, I believe “a” side in Phosphodiester bond refer to the side bond to 3’-C atom of…
Q: The genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a)…
A: The central dogma of molecular biology is the process of the formation of functional products by…
Q: Which amino acid would you expect a tRNA to be charged with if the TRNA has the anticodon 3' CUG 5'?…
A: Amino acids are biomolecules synthesized by the process of transcription and translation and form…
Q: Use the codon table to determine one possible DNA sequence that corresponds to the following amino…
A: A sequence of three consecutive nucleotides in a DNA or RNA molecule that codes for a specific amino…
Q: Use the genetic code table. Which amino acid is coded for by only one codon sequence? Second…
A: Ans is.. methionine
Q: With this DNA sequenec: - 5'-GCAATGGAGAGAATCTGCGCG-3'- - 3'-CGTTACCTCTGTTAGACGCGC-5' - -Identify the…
A: The process by which DNA gets converted into RNA molecule is called as transcription and then mRNA…
Q: Trypsin cleaves a polypeptide backbone at the C-terminal side of Arg or Lys residues, whereas…
A: Polypeptide is formed when amino acids are joined together with peptide bonds. Peptide bond is…
Q: This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top…
A: Transcription is the process of formation of mRNA transcript. It can be divided into three stages:…
Q: THE CODON TABLE FIRST POSITION SECOND POSITION THIRD POSITION TT UU UCU UAU UGU Phenylalanine…
A: Mutations are alterations in the genetic sequence. These alterations can be small or big. The…
Q: If a tRNA has an anticodon sequence 5'-CAU-3', What would be an amino acid carried by that tRNA?…
A: We know that the mRNA carries the codon and the tRNA carries the anticodon. The transfer RNA is the…
Q: Determine the sequence of a polypeptide treated with trypsin and chimotripsine. Below are the…
A: The sequence are:
Q: E. coli oriC is rich in A · T base pairs. Why is this advantageous?
A: E.coli is a gram-negative bacteria that is found in the lower part of the intestine if warm blood…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Like a helices, B sheets often have one side facing the surface of the protein and one side facing the interior, giving rise to an amphiphilic sheet with one hydrophobic surface. From the sequences listed below, pick the one that could form a strand in an amphiphilic B sheet. Think about the way side chains are arranged in a strand of a ß sheet (See Figure below). a) ALSCDVETYWLI b) DKLVTSIAREFM c) DSETKNAVFLIL d) TLNISFQMELDV e) VLEFMDIASVLD IINIIDetermine the sequence of a polypeptide treated with trypsin and chimotripsine. Below are the fragments generated with each treatment. Determine the original sequence for both fragmentations (reduerde that they must be equal in the order of amino acids) Quimotripsina 1. Leu-His-Lys-Gln-Ala-Asn-Gln-Ser-Gly-Gly-Gly-Pro-Ser 1. Gln-Gln-Ala-Gln-His-Leu-Arg-Ala-Cys-Gln-Gln-Trp 2. Arg-lle-Pro-Lys-Cys-Arg-Lys-Phe Trypsin 1. Arg 2. Ala-Cys-Gln-GIn-Trp-Leu-His-Lys 3. Cys-Arg 4. Gln-Ala-Asn-Gln-Ser-Gly-Gly-Gly- Pro-Ser 5. lle-Pro-Lys 6. Light 7. Phe-Gin-Gln-Ala-Gln-His-Leu-ArgConsider the following polypeptide sequence: Gly Val Tyr Ile Val Asp His Phe Thr Gly Asn Tyr Ala Leu Met Glu Asp Lys Aps Val Val Ala Tyr Glu His Ala Pro Lys Leu Asp Asp Phe Val Glu Glu Ala Ley Lys Val Glu Ala Gly Glu Val Pro Ala Ala Pro A) List the expected fragments that will result from proteolytic degradation with trypsin. B) List the expected fragments that will result from the reaction with CNBr. C) List the first three amino acids that will be identified by Edman degradation in the fragments generated in B).
- Consider the peptide Asp-Lys-Phe-Glu-Asn-Tyr-Gln-Val-Cys. In a single beaker, you treat this peptide with 2 proteases. One protease cleaves at the N-terminus of aromatic R groups and the other cleaves at the C-terminus of polar, non-ionizable R groups. Following the enzymatic digestion, you want to separate your peptide fragments so that you can identify them. You choose to separate the fragments using an anion exchange column. Beginning at pH=6 you apply your peptide fragments to the column and you gradually decrease the pH of the column stopping the separation when the pH of the column equals 4. Omitting chemical structures, write the amino acid sequence of the peptide fragments that are produced from this digest. Write the order that these fragments will elute from the column (if at all). (Relevant pKa values are: 2.1, 3.8, 4.3, 8.3, 9.6, 10.1, and 10.5)What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. Write out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro-Identify the primary sequence for the polypeptide that yields these fragments upon treatment: His-met-thr-met-ala-trp; Leu-asn-asp-phe; Val-lys obtained from chymotrypsin Leu-asn-asp-phe-his-met; Ala-trp-val-lys; Thr-met obtained from CNBR
- 5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13A tridecapeptide yields the following fragments when partially hydrolized. Determine the sequence of amino acids in the tridecapeptidedrolyzed. Determine the sequence of the tri decapeptide. tridecapeptide à lys-arg + gly-phe-pro + phe-ser-asp-lys + pro-phe-ser + asp-lys-arg-val + gln-ala-tyr + val-trp-gln. Determine the sequence of amino acids in the tridecapeptideA sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin, and the other with cyanogen bromide. Given the following sequences of the resulting fragments, deduce the sequence of the original peptide. Trypsin treatment: Asn-Thr-Trp-Met-Ile-Lys Gly-Tyr-Met-Gln-Phe Val-Leu-Gly-Met-Ser-Arg Cyanogen Bromide treatment: Gln-Phe Ile-Lys-Gly-Tyr-Met Ser-Arg-Asn-Thr-Trp-Met
- Second letter A UUU UCU) UC UCA UCG UAU UUC Phe UUA Tyr UGU UGCJ Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUG Leu CAUHIS CUU CUC CUA CUG CCU* C ССА CCG CGU His САС Leu CGC Arg CGA Pro CAA Gin CGGJ Gln Which amino acid is carried by the TRNA with the anticodon 5'-UCA-3? ACU ACC ACA AAU AAC. AGU AGC AGA AUU Ser Asn AUC Ile A AUA Thr AAA Lys AAG Lys AGG Arg AUG Met ACG GAU GGU] GUU GUC GUA GUGJ GCU GCC GCA GCG GAC Asp Ala GAA GGC Gly GGA Val GAG Glu GGGJ Isoleucine. None-this is a stop codon. Aspartic acid. Histidine. IV. Leucine O V. Third letter UCAG UCAG UCAG First letterdraw the structure of the peptide Asp - Asn-Ser-Lys-Pro at PH 8The OXA-M290 protein is next purified by size exclusion chromatography. To determine the best type of size exclusion resin to use, the size of OXA-M290 must first be determined. Earlier, you determined the amino acid sequence of OXA-M290 (MRVLALSAVFLVASIIGMPAVAKEWQENKSWNAHFTEHKSQGVVVLWNENKQQGFTNNLKRANQAFLPASSAKIPNSLIALDLGVVKDEHQVFKWDGQTRDIATWNRDHNLITAMKYSVVPVYQEFARQIGEARMSKMLHAFDYGNEDISGNVDSFWLDGGIRISATEQISFLRKLYHNKLHVSERSQRIVKQAMLTEANGDYIIRAKTGYDTKIGWWVGWVELDDNVWFFAMNMDMPTSDGLGLRQAITKEVLKQEKIIP). Based on the amino acid sequence, what is the molecular weight of this protein? You can use the free ProtParam tool (https://web.expasy.org/protparam/) to calculate the molecular weights of proteins. Make sure to include units in your answer. Note: The amino acid sequence reported earlier does not include the His-tag that was added to OXA-M290 by the pET-28a vector. However, you do not need to consider the amino acids in the His-tag in your answer to this question. For Context ONLY: For…