Label the 5' end and the 3' end of the future polymer and explain why this is the case 0 61810 6 CH₂ 012-0 0 CH -0-PIO CH₂ CH₂ OH CH OH CH LIFE: THE SCIENCE OF BIOLOGY Te, Figure 4.2 ©2017 Sinert
Q: Influence of buffer capacity and pH on tissue irritation
A: Knowledge of tissue behavior is essential for the diagnosis and treatment of diseases. By…
Q: Describe the main difference between the planarian and vertebrate digestive systems. Question 13…
A: Introduction:- Digestion involves the conversion of macromolecules like carbohydrates, lipids and…
Q: 18. A 1.5 % NaCl solution is hypertonic to red blood cells. What happens if red blood cells are…
A: A 1.5% NaCl solution is hypertonic to red blood cells. What happens if red blood cells are placed…
Q: Table 2. Week 53 in Mars greenhouse. H Environmental data at 12:00 p.m. Note from Luke: I don't…
A: The above question is referring to environmental data collected in a Mars greenhouse during week 53.…
Q: What is the indication that the orange syrup is deteriorating?
A: Food rotting is the procedure through which a product turns into unfit for consumption by the…
Q: 9-year-old boy complained of fever and sore throat over a 3-day period. On examination by his…
A: Acute Pharyngitis is cause by bacteria or virus but mainly cause by viruses.
Q: The researchers hypothesized that if resistant strains of group A streptococci existed in…
A: Group A streptococci (GAS) are a type of bacteria that can cause a variety of infections in humans,…
Q: What pieces of evidence are presented that prove or reinforce the connection between climate change…
A: Meteorological patterns: A weather pattern will develop if the weather is consistent for several…
Q: Using the Field of View (FoV) formula (Low Magnification/High Magnification)= (High Field of…
A: In this question , we have to determine the FOV(field of view). Given, FOV of 4x scanner is 3.2 mm…
Q: Mendel found that crossing wrinkle-seeded (rr) plants with homozygous round-seeded (RR) plants…
A:
Q: In this diagram, which of the following is TRUE? H+ (proton) Organic molecule that includes two…
A: Option B ) The NAD+ becomes reduced.
Q: for evolutionary biologist Do you think the content for eveolutionary biology is valid, credible,…
A: Evolution is a process which explain the present diversity of life on earth. It explains how life…
Q: what's the difference between research and scientific investigatory project?
A: Research is a kind of detailed study about something. It is done to have a better outcome and a…
Q: hospholipid bilayer protein Cholesterol protein cholesterol g the diagram above, which component of…
A: Plasma membrane also called as cell membrane which is selectively permeable, dyanamic and thin…
Q: Your client presents with pain in the hips. She reports being tired all the time and during the…
A: Introduction: When our parathyroid glands produce excessive amounts of parathyroid hormone in our…
Q: 11. Identify the chemical that gets oxidized in the following reaction: PEP + NAD+ → Pyruvate + NADH…
A: The science of chemical reactions that happen inside or relate to living beings is known as…
Q: Discuss the differences between conventional T cell therapy and Chimeric Antigen Receptor (CAR) T…
A: Introduction: Strategies for cancer treatment and medical research are continually changing to…
Q: 5. At a woman's blood analyses it was stated that: total concentration of osmotic-active substances…
A: The normal range of total concentration of osmotic-active substance in blood is about 300 to 325…
Q: 1. Case 2. Patient initials (Ex. 50-year-old man) 3. History of the present illness (Symptoms and…
A: According to Bartleby guidelines, we are required to attempt first three subparts in case of…
Q: In moose, brown coat color (B) is dominant to albino (no pigment) (b) and rough coat (R) is dominant…
A: In genetics, dominant and recessive refer to the relationship between two versions of a gene, called…
Q: For each combination of species, indicate whether the group they form would be monophyletic or…
A: A group of species that is monophyletic comprises all of its progeny as well as the common ancestor…
Q: An experiment was conducted looking at the likelihood to get covid when you are not vaccinated,…
A: The independent variable is the variable that is changed or manipulated by the researcher.
Q: In Dr. Kettlewell's experiment, What was behind the color change of the moth? Question 1…
A: Dr. Kettlewell's experiment: The experiment revealed that birds hunt on peppered moths selectively…
Q: Problem #1 In some chickens, the gene that produces color shows incomplete dominance. The gene will…
A: Incomplete dominance results from a cross in which each parental contribution is genetically unique…
Q: Explain what epigenetic theory is.
A: Greek for "epi" means "on or above," thus "epigenetic" refers to elements other than the genetic…
Q: describe the mechanism of how tissue damage leads to pain and how NSAIDs therefore provide…
A: Pain is a complex sensation that can be caused by various factors, including tissue damage. When…
Q: Label the diagram with the correct terms. XX A 2 A/ a 미 드 d
A: Introduction : Chromosomes are thread-like structures present in the nucleus. They are important…
Q: Briefly write on the characteristics and benefits of Healthcare Information System
A: A health information system is basically a system of different processes.This system mainly works to…
Q: form: Descriptive terms used to describe colony morphology: C Colony #: margin (edge): surface:…
A: Bacteria are unicellular prokaryotic microscopic organisms. One way to study them is to grow them on…
Q: In the post-industrial forest (dark forest), what did you notice about the bird's likelihood of…
A: The Industrial Revolution had a significant impact on the trees and the population of moths, in…
Q: what is the role of gene duplication, whole genome duplication, transposable elements, and…
A: Genome evolution refers to the changes that occur in the genetic makeup of an organism over time,…
Q: What are the observed genotypic frequencies for Wildrose at the pt-8 locus? and What are the…
A: The observed genotypic frequencies for Wildrose at the pt-8 locus are: 0.25 for PP, 0.50 for Pp, and…
Q: A child complaining of rectal itching and insomnia is most likely suffering from pinworm hookworm…
A: Introduction A parasite is an organism that lives in another organism, called the host, and often…
Q: In terms of classification, what are the 5 unique characteristics that place animals in the Phylum…
A: Kingdom Animala consist of many phylums. Mollusca is the second largest animal phylum and consists…
Q: Identify the glands of the endocrine system. Choose your answer from the box below.
A: Hormones are the chemical messengers of the body that travel through the bloodstream and help to…
Q: The following is based on the Seebeck effect: Select one: a. RTDs b. IR thermometers c. Thermistors…
A: Clinical thermometer It is an instrument that is used to measure body temperature and contains…
Q: Which larvae infect the host via penetration through the skin? Necator americanus rhabditiform…
A: Larvae are the immature stage of certain invertebrates, such as insects, worms and mites. They can…
Q: 20. How is oxygen and carbon dioxide exchanged across a lung cell membrane? a. diffusion b. C.…
A: Diffusion is the movement of molecules from a region of higher concentration to a region of lower…
Q: Compare and contrast the role and types of viral mutations in 1918 influenza type A virus and…
A: The 1918 influenza pandemic and the ongoing COVID-19 pandemic are both caused by viral pathogens…
Q: What is knockdown gene analysis? How is this different from knockout analysis?
A: Gene knockdown is a method in which temporarily stop or decrease the expression of one or more…
Q: what would happen to the action potential if the potassium channels opened before the sodium channel
A: Neurons and muscles have cells that generate an action potential in response to stimuli. These are…
Q: Which of the following statements is most correct? The electron transport chain - A: generates a…
A: Electron transport chain is a group of proteins Which transfer electrons through the mitochondrial…
Q: Barrel-shaped, bile-stained ova, with clear, prominent polar plugs at each end are characteristic of…
A: Trichuris trichiura The parasitic roundworm Trichuris trichiura, also known as Trichocephalus…
Q: Chlamydia trachomatis is an obligate intracellular pathogen. Discuss the interactions this microbe…
A: Chlamydia are gram negative obligate intracellular bacteria. As they lack peptidoglycan therefore…
Q: 3. Draw the needed cells and identify the number of chromosomes Scenarios A parent somatic cell with…
A: Somatic cell is a diploid cell which contains chromosomes in pairs. Haploid cell means that…
Q: explain briefly tye stages involved in phagocytosis by macrophages
A: Introduction Phagocytosis is the process by which specific live cells known as phagocytes consume or…
Q: Food going through the human digestive system only moves in one direction in some animals however…
A: The evolution of various kind of digestive system of animals helps them to digest their different…
Q: Explain, using three different microbes as examples, how a single microbial species can be…
A: Microbes are the tiny living things that can seen only through microscope. Microbes or…
Q: A scientist is evaluating the effects of soil nitrogen levels of chlorophyll concentration in…
A: Chlorophyll is the pigment that makes the plant green in color. Photosynthetic activity of the plant…
Q: Which of the following is NOT true of photosynthesis? The light-independent ("dark") reaction makes…
A: A) light independent reaction makes glucose from CO2 and water, using energy trapped by the…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- What is the sequence of the protein that would be translated from the following mRNA molecule? Use the single letter amino acid abbreviation for your answer. 5'- UGAUGUACCUCGCCUCUACGACGGAAUCCACA - 3'Biology QuestionPut the following anions in order from most nucleophillic to least nucleophillic: Br- I- F- Cl-
- What are the example of nanostructures? Give at least ten and define each Note: [Do not copy on Google!]Name the following nucleotide: HN -0-P -0-CH2 OHWhich is the correct name for the structure below? CH;OH НО OH Futton ations rive O a-D-arabinofuranose ebook O a-D-arabinopyranose Teams O B-D-arabinofuranose OB-D-arabinopyranose
- why is CH3-CH-CH2-CH2-CH3 non imposable ? I OHIndicate next to each letter the name of the monomers shown below and write the name of the polymer that is produced from the monomer. H-C-OH HỌ-C-H H-C-OH H-C-OH о- 6 CH₂OH 0=P-O О CH₂ Phosphate H group А: Name of polymer: H- Н Н OH H Sugar Н Н. H Nitrogenous base (adenine) C: 0 НО Name of polymer: H C-C-N CH2 SH Н НИ Н III H-N-С-С-0 +111 НКН н B: Name of polymer: Н 0 0-C-H o Н-С-0² H-C-O H S ННННННННННН Н Н Н LI -CH Н ННННННННННН Н Н Н ITIILE I C-C H ...... С-с-с-с-с-с-с III E .. ННННННННННН Н Н С-С-f 111 1 FE D: I НННННННННННННН No polymer!An enzyme catalyzes the hydrolysis of amide bonds. A synthetic polymer has amide bonds. Therefore, it is logical to say that this enzyme willcatalyze the hydrolysis of the synthetic polymer. Cite atleast 2 or more references
- OOC H₂C 1 H₂C H₂C H₂C-C HC H₂C NH N CON HN C COO™® 1 CH₂ CH₂ C-CH₂ CH C-CH, G=CH₂ "ooc H₂C H₂C H₂C H₂C-C HC 0-N H₂C Fe(ll) COO 1 CH₂ CH₂ C-CH₂ C-CH₂ G=CH₂ The structure below is Fe- protoporphyrin IX. It is linked by bridging groups to form porphyrin ring. Addition of Fe to the porphyrin rings produces the heme group. Identify the group of atoms that can for H-bond interaction with water.H HOH -он HOH H FOH но- но- -H- HO,Consider the structure of the tripeptide below. H O 11 H₂N-C-C-N-C-c- CH₂ CH₂ C=0 NH₂ pH 5: Z-I pH 10: H HN H O 11 CH₂ NH HIC- I-Z 0=6 -N-C-C-OH 1. What is the sequence of the tripeptide? (use the one-letter symbol, do not put dash or space in between symbols) 2. What is the net charge of the dominant structure of the tripeptide at the given pH values? The pK, values of the amino acids are given in Table 1. CH-OH T CH3 Table 1. pk, values of the standard amino acids.