If you have got the following DNA templatemolecules, which one of them will require more energy to break down the hydrogen bonds between the antiparallel strands? O a. GCGCGCGCGCGCGCGCGCGCG' О. GGGGGСССССААТТССССССС Oc. AAAAAATTTTTCCCCCGGGGG Od. TACTACACTGTGGTTAATTAAA O e. ATATATATCGCGTTAAATTCTA CLEAR MY CHOICE
Q: What do you mean by DNA polymerase δ?
A: Introduction: DNA polymerase δ is one of the multiple types of DNA polymerases found in eukaryotes.
Q: Which of the following sequences on a DNA moleculewould be complementary to GCTTATAT?a. TAGGCGCGb.…
A: Deoxyribonucleic acid (DNA) is a double-stranded molecule. It contains all genetic information that…
Q: Identify the template and non-template strand on the DNA. B TACGGATACG UACGGAUA ATGCCTATGC
A:
Q: Given the DNA strand with sequence 5' AUGGAGGAUGGCCAGUCAAUUUGA 3' match the various mutations to the…
A: Codon is a sequence of three nucleotides that corresponds to a specific amino acid. Codons encode…
Q: During DNA replication, the Okazaki fragments are Select one: O a. single-strand RNA O b. RNA-DNA…
A: Option c
Q: DNA strands are complementary to each other. If one strand has the nucleotide sequence ATTGGCCTT,…
A: DNA is composed of a backbone consisting of ribose sugar & phosphate, and nitrogen bases.…
Q: The following DNA sequence is at the start of a DNA strand: 3'—AATTCGAGATTCA—5'. Which of the primer…
A: The primer is the sequence of ribonucleotides which has free hydroxyl end for action of DNA…
Q: Assume a bacterial gene underwent a mutation, where a thymine base from an early portion of the…
A: Protein consists of amino acids.
Q: The following are DNA fragments containing a small gene. The top strand is the coding strand.…
A: The genetic information of all living organisms (except some viruses) is stored in the cell in the…
Q: Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT
A:
Q: If you have got the following DNA template molecules, which one of them will require more energy to…
A: The DNA is composed of purines and pyrimidines. The purines in DNA are adenine and guanine. The…
Q: The partial sequence of one strand of a double-stranded DNA molecule is…
A: Restriction endonucleases are the enzymes used in genetic engineering or DNA cloning in which…
Q: In 1984, Carolyn Greider was using out the enzyme called telomerase that had the ability to add…
A: Chromosomes are the structures formed by the organised arrangement of the DNA molecules located…
Q: Write out the resulting DNA molecules after the following double stranded DNA molecule is digested…
A: DNA stands for deoxyribonucleic and. It is the genetic material present in the cell.
Q: Here is a nucleotide sequence: ATGCAAGGTT. Choose the answer that correctly identifies both the type…
A: DNA and RNA are two nucleic acid polymers found in all living cells. Both are made up of nucleotide…
Q: Here is a nucleotide sequence: ATGCAAGGTT. Choose the answer that correctly identifies both the type…
A: Nucleic acids are one of the four main classes of biomolecules synthesized from monomeric units…
Q: the one above: Replicate this sense strand to create a double-stranded DNA helix…
A: DNA is a double helical structure containing complementary base pairs. Complementary base pairs…
Q: If a restriction enzyme cuts between the G and the A whenever itencounters the sequence GAATTC, how…
A: Answer is c.) four.
Q: If you have got the following DNA template molecules, which one of them will require more energy to…
A: Melting temperature is the temperature at which a double-stranded molecule of DNA is broken down…
Q: Which of the following is/are true regarding the enzyme primase? a: primase functions during…
A: DNA replication occurring in all organisms is the process of producing identical copies of DNA from…
Q: A DNA probe with sequence TCAGGCTTCAG would bind most strongly to which of the following DNA…
A: Gene probes are small, single-stranded DNA or RNA that hybridize with the target DNA sequences in a…
Q: Segment of DNA SGCTAACCTGATCGCCGGTATT 3'CGATTGGACTAGCGGCCATAAS 3' 1. Transcribe and translate the…
A: The change in nucleotide is called a mutation. it could be a point mutation when one nucleotide is…
Q: Consider the following segment of DNA, which is part ofa much longer molecule constituting a…
A: Deoxyribonucleic acid, or DNA, could be a molecule that contains the directions AN organism must…
Q: 17. You are presented with the following DNA molecule: 5 ATGCGATTATAA 3' 3' TACGCTA ATATT5' A. Write…
A: Given: A DNA Molecule: 5' A T G C G A T T A T A A 3' 3' T A C G C T A A T A T T 5' DNA =>…
Q: o drawings just writing the answer a) Replicate this sense strand to create a double-stranded DNA…
A: The central dogma of molecular biology is the process of replication, transcription, and translation…
Q: Shown are several single stranded DNA sequences written in the 5' to 3' direction. Which of the…
A: A hair pin structure will be formed due to internal base pairing in a DNA molecule.
Q: The bacterial repair system that corrects mismatched bases after polymerization is able to…
A: DNA stands for deoxyribonucleic acid. It is the genetic material of the organisms that transfer from…
Q: Suppose that you would like to amplify the DNA sequence below by a PCR reaction. Design 8 nucleotide…
A: A primer is defined as the short single-stranded DNA sequence, required in the polymerase chain…
Q: Please asap Original DNA template: 3'-ACGGTCAATTTGCTG-5 a) Transcribe the sequence. b) Translate the…
A: Given: Original DNA template: 3' - ACGGTCAATTTGCTG - 5'
Q: What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGCCCGTATAC -5…
A: DNA stands for deoxyribonucleic Acid. It is a long polymer of deoxyribonucleotides. It is found in…
Q: 1. Photoreactivation destroys the covalent bond by using the light energy from the UV light source…
A: Photoreactivation is the mechanism of DNA repair. This is a light-dependent repair mechanism. It…
Q: The sequences of four DNA molecules are given bel ii. TTTCCCGGGAAA AAAGGGCCCTTT iv. GCCGGATCCGGC…
A: DNA molecules are the nucleic acids that contain sugar, phosphate and nitrogenous base. Sugar is…
Q: What is the function of DNA gyrase? O a prevents the two complementary template strands from bonding…
A: DNA replication is the process of formation of replica of DNA. It involves various enzymes which…
Q: There are base pairing rules for writing complimentary DNA strands for a given strand. A pairs with…
A: According to Bartleby guidelines, we are supposed to answer first three subparts in case of multiple…
Q: Which of the following DNA double helices would be more difficultto separate into single-stranded…
A: DNA/ RNA is made up of bases purines and pyrimidines apart from phosphate and sugar. Chargaff's rule…
Q: A DNA probe with sequence TCAGGCTTCAG would bind most strongly to which of the following DNA…
A: DNA probes are single-stranded DNA segments that are hybridised to indicate the existence of…
Q: Below is the sequence of a single strand of a short DNAmolecule. On a piece of paper, rewrite this…
A: Cells are the most fundamental and essential unit of life in all living things. All of life's…
Q: . The DNA polymerases are positioned over the following DNA segment (which is part of a much larger…
A: Introduction DNA replication is very crucial process for the continuation of life as every new…
Q: The statement “DNA replicates by a semiconservative mechanism” means that (a) only one DNA strand is…
A: Introduction DNA replication is a semi-conservative and semi-autonomous process. Semi-autonomous…
Q: For the following DNA sequence: 3-CGATACGGCTATGCCGGCATT-5' The the sequence of the complementary DNA…
A: Complimentary base pairing Base pairing take place between a purine and pyrimidine. In DNA, adenine…
Q: Which of the following enzyme is used to join bits of DNA? O ligase primase O DNA polymerase O…
A: DNA replication occurs in the nucleus of the cell. DNA replication leads to the production of…
Q: plz explain with thorough explanation
A: Introduction : The physical appearance of an organism such as colour, height, which occurs as a…
Q: In DNA one strand runs "upside-up" while the other one runs in the opposite direction, "upside-down"…
A: The deoxyribonucleic acid (DNA) is the genetic material that consists of all the information…
Q: Suppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in…
A: Inversions are half-circle rotations of a region of a single chromosome. It is important to remember…
Q: Formation of a recombinant DNA molecule. GAATTC GAATTC CTTAAG CTAAG double-stranded DNA CAATTO…
A: Ans : In the given diagram, 1 is representing the restriction sites.
Q: If I tell you that a stretch of DNA in the 5' to 3' direction is AGGTACGACCGT Give me the…
A: Question -If I tell you that a stretch of DNA in the 5' to 3' direction is AGGTACGACCGT Give me the…
Q: 5'-AAGCGGGTGTGAGGAGCGCGGCAGCTCAGGTACCCCCGGCCAGGCGCG-3' 31-TTCGCCCACACTCCTCGCGCCGT…
A:
Q: Given the following template DNA strand, what is the correct complementary DNA sequence? 3' CGC AGT…
A: DNA has a double helix structure composed of sugar, phosphate group, and four nitrogen bases.…
Q: If you have got the following DNA template molecules, which one of them will require more energy to…
A: DNA is made out of four unique sorts of nucleotides, in particular, adenine, thymine, cytosine, and…
Q: B. Make identical strands of DNA CCTAT ATCTC TCTAT ATCTC TCATA CTGTG TGTCT CTATA (original) (new) C.…
A: The newly synthesized strand would always be complementary to the original DNA (and with opposite…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Step by step
Solved in 2 steps
- If you have got the following DNA template molecules, which one of them will require more energy to break down the hydrogen bonds between the antiparallel strands? O a. ATATATATCGCGTTAAATTCTA O b. AAAAAATTTTTCCCCCGGGGG O c. GGGGGCCCCCAATTCCCCCCC O d. TACТАСАСTGTGGTTААТТААA O e. GCGCGCGCGCGCGCGCGCGCG ype here to search ChpTake each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication Complement of each strand ii. Transcribe the complement strand of DNA into an mRNA strand Translate the mRNA strand into an Amino Acid strand iii. a. ATGGACGTATAGATGACAGGTAGATGTTTCAGGGGGATTTATCGATAG b. ATGGCCATTGAGTGTCAAAAGTCTCAATGA First base U UUU UUC UUA UUG CUU CUC C CUA CUG G U -phenylalanine (Phe) -leucine (Leu) GUU GUC GUA GUG leucine (Leu) AUU AUC isoleucine (lle) Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Second base ACU ACC AUA ACA AUG methionine (Met) (start) ACG -valine (Val) UCU UCC UCA UCG CCU CCC CCA CCG GCU GCC GCA GCG C -serine (Ser) -proline (Pro) -threonine (Thr) -alanine (Ala) UAU UAC UAA stop UAG stop CAU CAC CAA CAG AAU AAC AAA AAG A -tyrosine (Tyr) GAU GAC GAA GAG - histidine (His) -glutamine (Gln) - asparagine (Asn) -lysine (Lys) -aspartic acid (Asp) -glutamic acid (Glu) CGU CGC CGA CGG AGU AGC AGA AGG G -cysteine…1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocity
- Which of the following DNA double helices would be more difficultto separate into single-stranded molecules by treatment withheat, which breaks hydrogen bonds?A. GGCGTACCAGCGCATCCGCATGGTCGCGTAB. ATACGATTTACGAGATATGCTAAATGCTCTExplain your choice.Answer the following 2 questions based on the given sequence of DNA. The top strand is the template strand: 5’-CGTATAGCTCAGGGCGCTAACCTTAGCATGGACG-3’ (Template) 3’-GCATATCGAGTCCCGCGATTGGAATCGTACCTGC-5’ (Coding)Replicate the DNA strand AAGGCTAACGGCATTTAACCC. Transcribe the DNA strand AAGGCTAACGGCATTTAACCC. Translate your answer to #16 using the table below. Second letter A G UGU cys UGC UUU PheUCU UCC UCA UCG UAU1 UUC UUA UAC J Tyr Ser UAA Stop UGA Stop A UAG Stop UGG Trp G UUGLEU CAUTHIS CÁC CUU CUC CUA CUG CCU] CCC CCA CCG CGU] CGC Arg Leu Pro CAA GIn CGA CGG. CAGS ACU ACC ACA AAC FAsn AAA AGU Ser AGC AGA LArg Lys AGGJ AUU AAU AUC le A AUA The AUG Mer ACG AAGJ GAU ASP GACJ GUU GCU GCC GCA GCG GGU GGC Gly GUC Val GUA Ala GAAG Glu GAGJ GGA GUG GGG Third letter DUAG JCAG DUAG C. First letter
- I have a question I'm not sure about here it is...... If a short sequence of DNA is 5’-CGTAATCGGATC-3’, its complementary RNA strand is The answers given are: 5’- GCAUUAGCCUAG -3’. 5’- GAUCCGAUUACG - 3’. 5’-GATCCGATTACG - 3’. 5’-GCATTAGCCTAG - 3’.For the chromatogram below, what is the sequence of the template DNA from base 115 to 125? CTGTGTGAAA TTGT TA T C CGC T CACA A T TCCACA CA A CATACGAG CCGGAAG CA T AA 110 120 130 140 150 160 СТТТААСАAТА ТАTTCAATTТС ATAACAATTTC GAAATTGTTAT€ 2 A X 1_30*_SP23 - General Biology I (for majors)/11 f us page The anticodon sequence created from the following DNA: TACGGGGCTGAGATT Select one: a. AUGCCCCGACUCUAA O b. Met-Pro-Arg-Leu-STOP O c. UACGGGGCUGAGAUU O d. Tyr-Gly-Ala-Glu-lle 20 000 MacBook Air DII
- Given several unknown solutions, you are asked to use your knowledge of nutrient tests to identify the unknown substances in the vials. The substances used to create the unknowns are: galactose, olive oil, egg white (albumin), and starch.Each unknown vial contains one or more of these substances. The results of the tests are below. What substances are found in UNKNOWN #2? * Unknown #1 Unknown #2 turns blue after turns blue after Benedict's heating in a water Reagent bath heating in a water bath Sudan IV turns bright red Indicator upon addition turns pale pink upon addition turns brown upon turns black upon Lugol's Solution addition addition turns blue upon addition turns purple upon Biuret addition Reagent Your answerWhich of the following double stranded DNA molecules would require the most amount of energy to denature into single strands? GAGGTCTGG AGGGCGTAA GTATGGACT IV. TTTGGCTAT GAATTCATA Ov.For the following DNA sequence along a chromosome answer the following questions: The enzymes are working 5' ATGCATTAGACCACTAGCAT 3' left to right 3' TACGTAATCTGGTGATCGTA 5' 12. Is the top or bottom the leading strand? 13. On the leading strand only, start with a primer that is 5 nucleotide's long and then finish the rest as DNA polymerase would. Give me the entire strand of only the leading strand. 14. What enzyme copies the DNA by adding DNA nucleotides? 15. What enzyme links Okazaki fragments together on the lagging strand?