Here is the complete mRNA sequence from a bacterial cell: 5' ACUAGCAGGAGACGUAAGCGAUGUGCCAGAUGCGCAGUCACACAUAACUGCAAG 3' How many amino acids long is the protein? ○ 6 12 ○ 10 08 ○ 4
Q: The below pedigree shows a family with a history of the autosomal recessive genetic disorder Sickle…
A: Approach to solving the question:1. **Identify individuals with Sickle Cell Disease (SCD):** Start…
Q: +…
A: To determine the base sequences for a silent mutation and a non-silent (or missense) mutation in the…
Q: A bacterial strain is growing exponentially. At 1:00pm the titre of the culture is 2x10^3 cells per…
A: The objective of the question is to determine the number of generations that have elapsed, the…
Q: Answer the following
A: ANSWER : I'd be glad to help you with the onion male sterility crosses! Understanding the Crosses:In…
Q: A ALEKS - Julianna Graham - Lex ← -> +…
A: To predict the percentage of DNA that is radioactive after each experiment, we need to understand…
Q: Flowering plants (angiosperms) Conifers, cycads, Ginkgo gnetophytes (gymnosperms) Ferns & horsetails…
A: A paraphyletic group includes the common ancestor and some, but not all, of the ancestor's…
Q: Q13: In your own words, please explain how race is a social construct while ancestry is biological…
A: Q13: The concept of race is more about how societies categorize people based on physical traits,…
Q: 5. It is the responsibility of every employee to recognize and prevent harassment as soon as…
A: True. It is the responsibility of every employee to recognize and prevent harassment in the…
Q: Exame and describe the notable characteristics of the casts of Ardipithecus' hand and foot. What do…
A: The question is asking us to analyze and describe the significant features of the hand and foot…
Q: Figure 1 from Wilson et al. (1990) shows the locations of the primers and the length of the PCR…
A: Sure, let's break down the figure and the modifications made:1. **Orientation and Strand…
Q: Do you think the current conversation about abortion makes good arguments? If so, what is…
A: I hope these suggestions and recommendations help you with your assigned tasks. Have a great day…
Q: Answer in all option
A: Random genetic drift refers to the random fluctuations in allele frequencies within a population…
Q: esc A ALEKS-Julianna Graham - L x 5 Grades for Julianna Graham: C…
A: The molecules in the image are all aldoses, a type of monosaccharide with an aldehyde functional…
Q: Immanuel Kant’s Investigation of the Question Whether the Earth Has Undergone Any Change in Its…
A: The objective of the question is to understand the theory proposed by Immanuel Kant in his work…
Q: The Centers for Disease Control and Prevention (CDC) program PulseNet uses genomic fragments that…
A: Pulsenet uses highly multiplexed amplicon sequencing (HMAs) panels for surveillance subtyping. It…
Q: solve this with step by step calculations for every question please
A: In case you need help understanding these answers, here are non-technical explanations of each:1.…
Q: Considering the advantages and disadvantages of using different drugs, would you allow the use of a…
A: Approach to solving the question:Researched through Books and online resources/ reference with…
Q: ts/1185957/variants/1185957/take/4/ 1 Poin 08 MULTIPLE CHOICE Question 3 You observe a high energy,…
A: The question is asking us to identify a type of radiation that is high energy, has a short…
Q: Leydig cells are found in which male reproductive organ? Group of answer choices Seminal Vesicles…
A: Leydig cells, also known as interstitial cells of Leydig, are found in the male reproductive system.…
Q: How did all the different body types in the Cambrian arise so quickly? O Hox genes had evolved that…
A: In the field of evolutionary biology, the quick appearance of many body shapes during the Cambrian…
Q: For the following diseases with their potential pedigree, mode of inheritance and the responsible…
A: This indicates that the condition is not inherited from the father in this case, as he is affected…
Q: Complete this sentence: The number of your genetic ancestors is [Select] lower than the same as…
A: Detailed explanation: The number of your genetic ancestors is LOWER THAN the number of your actual…
Q: Here is the complete mRNA sequence from a bacterial cell: 5'…
A: In protein synthesis, the process of translation converts the sequence of the mRNA (messenger RNA)…
Q: One of the two genes known to be mutated in cases of Hypokalemic periodic paralysis (which is…
A: Approach to solving the question: Detailed explanation: Examples: Key references:
Q: A woman takes an antibiotic to relieve a urinary tract infection caused by Escherichia coli. The…
A: The answer explained that a woman developing a yeast infection after taking antibiotics for a UTI is…
Q: Genetics Question 1
A: Since Violet has the same genes as Ramone and Tina in both Gene 1 and Gene 2, it suggests that she…
Q: From which animal was the pancreas used to extract insulin in 1921?
A: The objective of the question is to identify the animal from which insulin was first extracted in…
Q: make a pathophysiology flow chart of Upper Respiratory Tract Infection with a data of: 3 months old…
A: The objective of the question is to understand the pathophysiology of an Upper Respiratory Tract…
Q: Clara was solving the equation 4n+2−3(2−n)=31 the work for which is shown below.
A: Clara is solving an equation, which means she's trying to find the value of "n" that makes both…
Q: step by step calculations please
A: For the first column:Concentration = 180 ng/ulVolume = 25 - 0.4 ul = 24.6 ulng DNA = 180*24.6 =…
Q: A certain ochre suppressor inserts glutamine in response to the ochre codon. What is the most likely…
A: In this scenario, where a suppressor mutation allows the insertion of glutamine instead of…
Q: The pure “fire air” consumed by a burning candle in a sealed glass jar, or by a mouse during aerobic…
A: The objective of the question is to identify the element(s) present in the 'fire air' consumed by a…
Q: please solve this step by step calculations
A: Detailed explanation:1. Protein concentration in the original sampleIn an assay tube, you have…
Q: The question is:
A: Approach to solving the question: I hope this helps!! Detailed explanation: Examples: Key…
Q: Read over the following article from the New York Times. It describes a study in which researchers…
A: Answer 1: Summary of the article:Study Objective: Researchers wanted to understand how muscles…
Q: You are studying a protein-protein interaction in 2 proteins. You decide to test both these proteins…
A: Approach to solving the question:Disulfide bonds unlikely:Disulfide bonds are probably broken by the…
Q: Please answer this four question it Anthro work. Please do it now
A: Approach to solving the question: Detailed explanation:1. B2. Traits:Shape and Size: Human bones…
Q: In flow cytometric analysis of leukocytes, side scatter measurement is used to estimate which of the…
A: The objective of the question is to understand what side scatter measurement in flow cytometric…
Q: Can you please check if these answers are correct, if not please correct them.
A: Aerobic respiration is the process where glucose is completely oxidized in the presence of oxygen.…
Q: 10. How can you promote independence while the person is taking a bath? Ask the family to help.…
A: Approach to solving the question: Select the best option Detailed explanation: Encouraging the…
Q: Hydrolysis of a polysaccharide is accompanied by order. AG and negative increased zero unpredicted…
A: This is because the hydrolysis of polysaccharides, like the breakdown of starch or cellulose into…
Q: 3. Which of the following best describes retaliation for a claim of harassment? An action taken…
A: An action taken by a harassment victim against the harasser - This option is incorrect because…
Q: This image shows how cells in the medial superior olive could hypothetically calculate interaural…
A: Detailed explanation:Yes, of course! The processing of interaural time differences (ITDs), or…
Q: How to solve the genotype, allele, and phenotype frequency.
A: The first step is to compute the allele frequencies: Allele frequencies are numerical…
Q: make a pathophysiology flow chart of Upper Respiratory Tract Infection with a data of: 3 months old…
A: The objective of the question is to understand the pathophysiology of an Upper Respiratory Tract…
Q: 2. Which of the following actions is harassment based on race? An African-American employee is…
A: An African-American employee is subjected to racist remarks from co-workers to the point that she is…
Q: The Swedish botanist Carolus Linnaeus was the first taxonomist to argue that, contrary to Aristotle:…
A: The question is asking about the classification system proposed by the Swedish botanist Carolus…
Q: Genetics Q3
A: The question is asking about the component of the CRISPR-Cas9 system that connects the Cas9 enzyme…
Q: Drag and drop from the available list of terms. The synthesis of complex molecules is reaction,…
A: The building of complex molecules, such as sugars, from simpler ones is an anabolic process and is…
Q: The amount of this in the cell rises as DNA synthesis begins. Cis-acting element that can increase…
A: Step 1: Step 2:Step 3: Step 4:
Step by step
Solved in 2 steps
- Consider the following mature mRNA from a human cell: 5' UAAUGUCGCAAUAACC 3¹ What is the sequence of amino acids in the translated protein? Second letter A First letter С U d A G บบบ UUC P U UUA UUG Leu CUU CUC CUA CUG GUU GUC GUA GUG -Phe Met-Ser-Gln Met-Arg-Lys-Ser Leu Stop-Cys-Arg-Asn-Asn C AUU AUC lle AUA ACA AUG Met ACG Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC GCU GCC GCA GCGJ Ser Pro Thr Ala UAU UAC Tyr UGU UGC. UAA Stop UGA Stop UAG Stop UGG Trp CAC CAGGin CAU His Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. AAU Asn AAA Lys AAG. There is no start codon, resulting in no translated protein. GAU ASP GAC Glu GAA GAG G CGU CGC CGA CGG Cys AGU AGC AGA AGG Arg GGU GGC GGA GGGJ Arg ser Gly MCAG U UCAG с А SCAG U SCAG U Third letterFor the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG GConsider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?
- The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown below. The ORF is in CAPITAL LETTERS 5’-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACCAATAGaaatattatttaa-3’ 3’-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGGTTATCtttataataaatt What is the length in AA’s of the Sh protein? Assume fMet is NOT CLEAVED [10%] 39 AA 13 AA 12 AA 21 AAThe bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown below. The ORF is in CAPITAL LETTERS 5’-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACCAATAGaaatattatttaa-3’ 3’-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGGTTATCtttataataaatt-5’ Answer the following questions: Q1. Which is the coding strand? Which is the template strand? [10%] Top-bottom. Bottom-Top. Both can be used as either coding or template for this gene.The BNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U P с > < A G U UUU UUC Phe UUA UUG CUU CUC CUA CUG L GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala Cys UAA Stop UGA Stop A Trp UAG Stop UGG CAC His CGU J CGC CAA I CGA Gin CAGG CGG AAA 1 AAG Lys UGU UGC AAU Asn AGC} AAC GAC Asp GAA GAGGIU For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). BIUS Paragraph V Arial G 1 AGA 1 AGG GGU GGC GGA GGG Arg Ser Arg Gly V DCAG DCA DOA UCAG Third letter 10pt < Av V IX Q ... O WORDS POWERED BY TINY
- what is the anticodon sequence that would build this protein? AUGUUUGUACAUUUGUGUGGGAGUCACCUGGUUGAGGCGUUGUAUUUGGUUUGUGGCGAGCGCUUUUACCAGUUAGAGAAUUACUGAWhat is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are shown below. DNA sequence: 5’ - AGCATCTCATGTGCGAGTCCTGACGCTGACTAGC – 3’ 3’ - TCGTAGAGTACACGCTCAGGACTGCGACTGATCG – 5’ mature mRNA: 5’ – cap-AUCUCAUGUGCGAACGCUGACUAGAAAAAAAAAA- 3’ Draw boxes around any structures or bases that were added to the RNA during processing.
- The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are shown below. DNA sequence: 5’ - AGCATCTCATGTGCGAGTCCTGACGCTGACTAGC – 3’ 3’ - TCGTAGAGTACACGCTCAGGACTGCGACTGATCG – 5’ mature mRNA: 5’ – cap-AUCUCAUGUGCGAACGCUGACUAGAAAAAAAAAA- 3’ How many amino acids are in the peptide encoded by the gene? _____________The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are shown below. DNA sequence: 5’ - AGCATCTCATGTGCGAGTCCTGACGCTGACTAGC – 3’ 3’ - TCGTAGAGTACACGCTCAGGACTGCGACTGATCG – 5’ mature mRNA: 5’ – cap-AUCUCAUGUGCGAACGCUGACUAGAAAAAAAAAA- 3’ In the DNA sequence, draw boxes around two exons in the gene. The splicing machinery does NOT pay attention to codons. The splicing of this DNA demonstrates that. How?Below is the DNA sequence of a gene, what is the protein sequence? 5'-GGTAAGCTAGCTATGACTACCCTGACATAGATATCGACTAGCTG-3' Insert the amino acid sequence using the single letter designation for the amino acid (ex: use ACG instead of AlaCysGly). Include only the letters in the correct order as they would be translated using no commas, no spaces and no dashes.