Firstname :JEDD Surname:ALCANTARA wwwwww PART C. Give the name of the polypeptide as a single molecule of your full name from B.[4pts]

Q: TABLE 3-LACTATE PRODUCTION IN FORTIFIED HEMOLYSATES OF HUMAN ERYTHROCYTES* Substrate Glucose Glucose…

A: Detailed explanation: b): In mature erythrocytes (red blood cells), the end product of glycolysis is…

Q: Please help me fill in all the information

A: In order to finish your diagram, you would have to: Assign the proper labels to Complexes I, II (if…

Q: Which statement is false? ○ Each chain of collagen adopts a right-handed helix ○ Disulfide linkages…

A: Step 1:     The false statement is : Silk resists stretching because of its β conformation.…

Q: [AktivGrid] Draw the product of the reaction of isocitrate catalyzed by isocitrate dehydrogenase in…

A: Kreb cycleKreb cycle or citric acid cycle or tricarboxylic acid cycle (TCA) is a sequence of…

Q: A 4. Rank the following polymers in order of hydrolysis rate. (6 pts) B C Faster n D Slower

A: Approach to solving the question:Step 1: Identify key factors affecting hydrolysis rateBond…

Q: Which of the following statements accurately describes differences in beta oxidation vs fatty acid…

A: The objective of the question is to identify the accurate statements that describe the differences…

Q: 9. a. Which class of enzymes do poisonous snakes use to rock your world when they bite their prey?…

A: The objective of the question is to identify the class of enzymes used by poisonous snakes when they…

Q: (Biochemistry Topics: Glycolysis and Citric Acid Cycle)  - Which of the following molecules can…

A: Gluconeogenesis refers to the process of production of glucose from non-carbohydrate sources.…

Q: Now consider three sugars-glucose, glucuronic acid, and N-acetylglucosamine. Use shorthand (e.g.,…

A: The objective of the question is to identify the correct shorthand notation for the trisaccharide…

Q: With regards to antibodies define the following terms in the space belowa. CDRsb. Constant regions

A: a. CDRs (Complementarity-Determining Regions):CDRs are specific regions within the variable domains…

Q: No need to upload any image just give me the answer with proper explanation.

A: The structure shown in the image is of a molecule that appears to be a synthetic opioid. Based on…

Q: Suppose the concentration of glucose inside a cell is 0.4 mM and the cell is suspended in a glucose…

A: The following equation describes the mathematical relation for the change in free energy (ΔG)…

Q: 8. Write the systematic name for each glycosidic bond. HO CON OH 6-CH₂ OHHO OH 8-CH₂ O OH HO OH…

A: Glycosidic bonds are covalent bonds which connect monosaccharides to form disaccharides and…

Q: a)Dr. Thisisaneasyexam decides to amplify a gene from a plasmid using PCR. She starts out with 6.6 x…

A: Sure, let me provide a more detailed explanation for the calculations.a) Calculating the number of…

Q: The RNA sequence below encodes a very short protein: 5’ ACCGUACGACCAUGUCCCACUAUCCCUAGGCGAUC 3’…

A: Start and Stop Codons:In the genetic code, certain codons have specific roles. The codon "AUG"…

Q: The following table provides data on three popular protein supplements. (Figures shown correspond to…

A: Let the number of servings of designer whey be 'x' and the number of servings of muscle milk be…

Q: Your colleague handed you a novel strain of coli that is purifying a protein with a 6xHisTag; they…

A: Detailed ExplainationCompetitive Metal Chelation:Dicarboxylic acids, such as citric acid, have…

Q: None

A: To correctly match the terms with their appropriate properties, we need to examine each term and…

Q: 4. (4 pts) a) Describe one way in which Rubisco could be improved to optimize photosynthetic…

A: Rubisco, or Ribulose-1,5-bisphosphate carboxylase/oxygenase, is the most abundant protein in the…

Q: Session 21180406 matching question Identify the type of lipid based on the structural features. 1st…

A: Lipids are a chemically diverse group of biomolecules that have two things in common:low solubility…

Q: Formic acid is in the venom of some ant species. What is the pH of a 0.5 M solution of formic acid…

A: For weak acids, we can use the equilibrium constant (Ka) and the initial concentration of the acid…

Q: Which of the following could act as one of the substrates in a reaction catalyzed by a…

A: Let's break it down in detail:Glycosyltransferases are enzymes responsible for catalyzing the…

Q: STEM Workplace Practices Q4

A: The objective of this question is to understand the difference between a product contaminant and a…

Q: What is the IUPAC name of the following compound? (No need to provide E/Z designation.) CO₂H

A: IUPAC name is 3,3,6-Trimethylhept-6-enoic acidExplanation:Step 1:Rules for IUPAC Naming Find the…

Q: 5. Draw head group structures and name the following glycerophospholipid. a: Glycerophospholipid…

A: ### a: Glycerophospholipid that carries a net positive charge at pH 2.5.At a low pH such as 2.5, we…

Q: Draw the product AND propose a reasonable, detailed stepwise mechanism, using curved arrow notation…

A: here in first step in presence of base H+ ion is removed from alpha position of carbonyl carbon and…

Q: Why is 1, 2, 3, 4-tetraphenylcylopentadienone a dark purple color while most other organic compounds…

A: Option a: This option is incorrect because, 1, 2, 3, 4 - tetraphenylcylopentadienone is not a…

Q: 2. The mature form of TEM-1 ß-lactamase, an enzyme of 290 amino acid residues that hydrolyzes…

A: Before calculating the isoelectric point (pI) of the enzyme, we need to be thorough with the…

Q: Draw the skeletal structure of a wax formed from arachidic acid, CH3(CH2) COOH and the alcohol,…

A: Steps to draw skeletal structure :1. Identify the reactants: The reactants given are arachidic acid…

Q: With the ninhydrin method, it was determined that an acyclic decapeptide consists of the following…

A: Elastase cleaves the peptide bonds formed by small hydrophobic amino acids, towards the C-terminal…

Q: Model 1 - Linear electron flow during the light reactions Identify each of the numbered elements…

A: Answers are given below:1. O22. H2O3. Primary Acceptor4. Pq (Plastoquinone)5. Cytochrome complex6.…

Q: You are working as a protein engineer. You decide to work on lacl protein ( This is the repressor…

A: An operon is a cluster of genes under a single promoter. The gene products of genes in an operon are…

Q: If the anticodon of an alanyl-tRNA is IGC (inosine-guanine-cytosine), to which of the following…

A: In order to answer this question, we must be familiar with Wobble hypothesis. We know that the mRNA…

Q: Calculate the equilibrium membrane potentials to be expected across a membrane at 37 ∘C, with a NaCl…

A: The objective of this question is to calculate the equilibrium membrane potential across a membrane…

Q: How is plasmid DNA distinguished from coli chromosomal DNA using the Qiagen Miniprep protocol?

A: In the Qiagen Miniprep protocol, plasmid DNA is distinguished from E. coli chromosomal DNA based on…

Q: (Biochemsitry, Topics: Glycolysis and Citric Acid Cycle)  - How many ATP are formed from the…

A: The complete oxidation of fructose in the liver involves a series of biochemical reactions that…

Q: Consider the following Peptide: Alanine-Lysine-Glutamine-Serine-Glycine Select all that applies…

A: Peptides are short chains of amino acids linked by peptide bonds ( the bond between CO and NH in…

Q: 7. Consider the structures shown. For each structure select all that apply. a) pentose, hexose or…

A: Answer and its explanation are given below.I hope it helps you Explanation:

Q: (e) What kind of inhibitor is it likely to be? Plot the data in Lineweaver-Burk plot form to support…

A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…

Q: You have a protein with MW 48kDa. How many grams of protein are in a 200 mL sample at 50 μM?

A: To calculate the amount of protein in grams in a 200 mL sample with a concentration of 50 μM, follow…

Q: raw the reaction between sphingosine and arachidonic acid. Draw out the full structures.

A: Sphigosine is the platform molecule of sphingolipids. Arachidonic acid is a 20 carbon fatty acid…

Q: The oxyanion hole of a serine protease has which of the following roles (select all correct…

A: The objective of the question is to identify the roles of the oxyanion hole in a serine protease.…

Q: The 5’ cap is involved in all the following except:   Question 19 options:   Splicing exons…

A: The processing of mRNA formed from transcription is called post transcriptional modification. Thes…

Q: To oxidize the fatty acid molecule shown below, what enzyme(s) are needed in addition to the enzymes…

A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons.…

Q: STEM Workplace Practices Q5

A: The statement is false. Analytical methods are not assessed only once in their lifecycle for…

Q: For protein expression, a different strain of Coli is being employed than the one used for plasmid…

A: Approach to finding a solution to the problem:Microbiological, biochemical, and molecular approaches…

Q: Consider the following structure. CO₂CH2CH3 CO₂CH2CH3 This substance could be produced by the…

A: True.As it was a Diels-Alder Reaction so the given structure will be produced.Explanation:It is a…

Q: Question 12 In the tertiary structure of a protein, the R-group of valine can interact with the…

A: Proteins are bio molecules with vast diversity in their structure. They exhibit four levels of…

Q: Under low tryptophanyl-tRNA (tRNAtrp), we expect the trp operon to be expressed because:   Question…

A: Trp operon functioning in the bacterial system Escherichia coli consists of a set of genes that…

Q: PART IV. HOW FAST DOES IT GO?Another member of your research group studied the kinetics of theGAPDH…

A: The objective of the question is to determine the Michaelis-Menten constant (Km) and the maximum…