Explain the process of transcription in prokaryotes, including the following: promoter region, RNA polymerase, 5’-3’ direction, free nucleoside triphosphates, complementary base pairing, terminator region.
Q: The recognition sequence to which RNA polymerase binds at the initiation of transcription is found…
A: Ans- False The recognition sequence to which RNA polymerase binds at the initiation of transcription…
Q: What are the differences between translation and transcription in bacteria and eukaryotes? Give a…
A: Differences: Bacteria…
Q: Is chromatin structure is altered in transcription? Explain
A: Solution- Chromatin- It is a thread like structure in nucleus. it's uncondensed molecules of DNA…
Q: Give the structure of transcription in eukaryotes?
A: Eukaryotic transcription is the intricate mechanism used by eukaryotic cells to copy genetic…
Q: List five events other than transcription initiation thatcan affect the type or amount of active…
A: A eukaryotic cell contains a nucleus, membrane-bound organelles, and cytoplasm which are enclosed by…
Q: Describe the steps of transcription in bacteria
A: Introduction - In the nucleus, transcription occurs. To make an RNA (mRNA) molecule, it uses DNA as…
Q: Transcription Translation stop site start site Intron 1 Promoter Exon 1 Exon 2 Intron 2 Exon 3 |…
A: Any alteration in the nucleotide sequence of a gene is mutation. A mutation in the gene sequence can…
Q: Outline the three stages of transcription and the role of RNApolymerase in this process.
A: Transcription is a process of transcribing the template DNA into complementary mRNA sequence which…
Q: Explain the process of splicing,capping and tailing which occur during transcription ineukaryotes?
A: Transcription is a process by which m-RNA is formed from DNA sequence. The process of transcription…
Q: Which of the following is a sequence of DNA where transcription is initiated? a. Kozak sequence.…
A: Transcription is a heterocatalytic action of an DNA by means of which RNA is synthesized from…
Q: Describe the process of transcription, focusing on the role of RNA polymerase, sigma (σ) factors,…
A: Transcription is a process of transcribing the template DNA into complementary mRNA sequence which…
Q: Describe the steps of transcription in eukaryotes
A: Eukaryotic transcription is carried out in the nucleus of the cell by one of three RNA polymerases,…
Q: Which of the following statements regarding transcription is true? Helicase unwinds the DNA helix to…
A: Transcription is the process of formation of sequence of RNA using DNA as a template and DNA…
Q: Give two reasons why both the strands are not copied during transcription?
A: Processes of synthesizing RNA from DNA with the help of an enzyme RNA polymerase is termed as…
Q: Which of the following are considered a transcription activator?
A: option B) CAP protein in E.coli
Q: in m 5'- 3'- Shown below is a schematic diagram illustrating a very short gene with 3000 bp region…
A: Transcription is the process of formation of transcript that is mRNA from DNA. It is catalysed by…
Q: Explain the steps of Eukaryotic Translation Initiation. 1. Formation of preinitiation complex. 2.…
A:
Q: Which of the following statements regarding transcription is true? Helicase unwinds the DNA helix to…
A: Each nucleotide comprises three elements in a nucleic acid. One such component is a five-carbon…
Q: Arrange the processes involved from Transcription to Translation. RNA polymerase binds in the…
A: The central dogma is the process through which information from DNA(deoxyribonucleic acid) is…
Q: Provide the correct sequence of steps in each process described below. Write the letters in series…
A: DNA or Deoxyribonucleic acid is the genetic material contained in most complex, higher organisms. It…
Q: Discuss the function of enhancer sequences ineukaryotic transcription
A: The eukaryotic transcription is an elaborate process in which eukaryotic cells use to copy genetic…
Q: During RNA chain elongation gyrase proceeds ahead of the transcription bubble in order to
A: This topic is based on transcription bubble.
Q: Listed below are steps in the transcription process. Reorganize the list so the steps in the…
A: Correct steps of Transcription are as follows. 1. General Transcription factors bind TATA box…
Q: Describe the steps in transcription that require complementary base pairing
A: Transcription is a process of synthesis of ribonucleic acid (RNA) especially messenger ribonucleic…
Q: Describe the process of transcription in eukaryotes from the time the RNA polymerase binds to the…
A: The process of transcription in eukaryotes occurs in the nucleus of the cells and it includes the…
Q: Gene transcription occurs from left to right for gene A and gene B, whereas transcription occurs…
A: The process by which a cell makes an RNA copy of a piece of DNA. This RNA copy, called messenger RNA…
Q: process of eukaryotic transcription in detail and mention the specific enzyme
A: Transcription can be defined as the process of copying genetic information from one strand of the…
Q: Explain about Formation of the RNA Polymerase II Transcription Initiation Complex ?
A: The process of transcription (synthesis of RNA from DNA) is initiated when RNA polymerase binds to…
Q: Differentiate prokaryotic transcription from eukaryotic transcription.
A: The cells are the basic structural and functional unit of all known organisms. The cells are…
Q: Describe events associated with the process of transcription in eukaryotic cells. How is the process…
A: RNA polymerase II transcribes protein-coding genes into messenger RNAs (mRNAs) that carry the…
Q: Explain how transcription is initiated in eukaryotic cells.
A: Eukaryotes are those organisms whose cells have a nucleus that is enclosed within a nuclear…
Q: The following DNA nucleotides are found near the end of a bacterial transcription unit.…
A: Transcription is the process by which the information in a strand of DNA is copied into a molecule…
Q: Explain how an α helix in a transcription factor protein is able to function as a recognition helix.
A: Transcription is the first step in central dogma of protein synthesis. It involves formation of…
Q: Describe the procedures involving the initiation of transcription in bacteria cells
A: Bacterial transcription is the process of using the enzyme RNA polymerase to copy a section of…
Q: Name the factor of RNA polymerase enzymes which recoganise the start and termination signal on DNA…
A: All transcription in bacteria is performed by the single type of RNA polymerase. This polymerase…
Q: Discuss the three steps of Transcription (Initiation, Elongation, Termination).
A: The process of transcribing a piece of DNA(deoxyribose nucleic acid) into RNA(Ribose nucleic acid)…
Q: Which of the following components is involved in the initiation of transcription? Group of answer…
A: Reply and Explanation: 1 Record begins when a record factor ties to the advertiser alongside a RNA…
Q: Discuss in detail the process of transcription. proper explanation and diagram
A: Ans: Transcription: The synthesis of mRNA from DNA using RNA polymerase is referred to as…
Q: List and describe the sequential steps of TRANSCRIPTION in prokaryotic (bacterial) cells
A: Transcription is a very important event and it is a part of the central dogma. DNA contains genetic…
Q: Microbiologists describe the processes of transcription and translation as “coupled” in bacteria.…
A: DNA serves as a genetic material and carries genetic information from one generation to another. DNA…
Q: Explain how general transcription factors and RNA polymerase assemble at the promoter and form an…
A: Introduction Transcription is the process of formation of RNA transcript form the segment of DNA…
Q: A gene will have a sequence of DNA in front of it that directs the RNA polymerase to where to begin…
A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…
Q: TACGGTACGATT CYTOPLASM Transcription a. On the diagram, draw a circle around the part that…
A:
Q: Explain what is meant by the coupling of transcription and translation in bacteria. Does coupling…
A: Transcription is a process of the formation of RNA from DNA. This DNA is further responsible for the…
Q: Transcription in eukaryotes requires which of the following in addition to RNA polymerase? Choose…
A:
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Explain the process of transcription in prokaryotes, including the following: promoter region, RNA polymerase, 5’-3’ direction, free nucleoside triphosphates, complementary base pairing, terminator region.
Step by step
Solved in 2 steps
- Draw a labelled diagram depicting the flow of genetic information from DNA to mRNA of a eukaryoticprotein-coding gene. Indicate the following on your diagram: DNA, pre-mRNA, mRNA, gene,promoter, transcription start site, exon, intron, terminator, AAUAAA, 5’ UTR, 3’UTR, protein codingsequence, start codon, stop codon, 5’ cap, poly A tail.Indicate which of the following items are associated with transcription or translation. This could be in prokaryotes or eukaryotes, or both. Group of answer choices: Translation OR Transcription Sigma binds to the promoter mRNA binds to the small ribosomal subunit Spliceosomes remove introns and splice together exons Nucleotides are added from the 5' to 3' end tRNA anticodon binds to the corresponding mRNA codon STOP codon results in terminationWhat is the production of RNA called and what is the enzyme that catalyzes the process?What are the similarities and differences between the transcription process and the repli-cation processes?Concerning their biological function what is the difference between DNA and RNA? Is there any situation in which DNA is made based on a RNA template? If there is,explain with an example how it occurs and state the enzyme involved?What is the difference between plasma membrane and cell wall?
- What polypeptide would be produced from the following strand of DNA? The first pair of nucleotides (bolded) contains the start point of transcription. Label the C-terminus and N-terminus ends of the polypeptide. 3’-ATGCCTACGGGTACGCCACTACTCCC-5’ 5’-TACCCATGCCCATGCGGTGATGAGGG-3’The following segment of DNA is part of the RNA-coding sequence of a transcription unit. If the bottom strand is template, which of the following RNA sequences would be transcribed? DNA: 5-'ATAGGCGATGCCA-3' 3'-TATCCGCTACGGT-5' O 5'-UAUCCGCUACGGU-3' O 5'-ACCGUAGCGGAUA-3' O 5'-AUAGGCGAUGCCA-3' O 5'-UGGCAUCGCCUAU-3'Match the statement that corresponds to the specific type of transcription and translation. Choices: Eukaryotic Translation Prokaryotic Translation and Transcription Both Prokaryotic and Eukaryotic Transcription Prokaryotic Transcription Prokaryotic Translation Both Prokaryotic and Eukaryotic Translation Eukaryotic Transcription 1. RF1 and RF2 recognize the three bases to terminate the process 2. TATA box in the promoter region 3. single mRNA codes for the proteome 4. methionine is removed 5. simultaneous and rapid process producing mRNA and polypeptide 6. eRF recognizes UGA 7. dozen of initiation factors involving methionyl tRNA * 8. rho factor and sequence of uracil in a loop conclude the process 9. ribosome propels to the next bases 10. sigma factor binds to RNA polymerase in the promoter region 11. regulating elements in the operon 12. cleaving the polypeptide by adding water 13. removal of gene segment disrupting the message 14. CAAT box is found 80 nucleotides from the…
- Listed below are steps in the transcription process. Reorganize the list so the steps in the correct order- starting with the first step in initiating transcription and ending with completion of a new strand of RNA (in other words- from start to finish of transcription). RNA polymerase reaches the termination signal DNA unwinds underneath RNA polymerase at transcription start site RNA polymerase is recruited to the promoter region mRNA transcript is released General Transcription factors bind TATA box (and other DNA sequences) in the promoter region General Transcription Factors unbind from promoter region mRNA transcript synthesis occurs RNA polymerase moves along the template strand in the 3’ to 5’ directionThe following double-stranded DNA sequence is part of a hypothetical yeast genome which contains a very small gene. Transcription starts at the Transcription Start Site (TSS), proceeds in the direction of the arrow and stops at the end of the Transcription Terminator (green box). 5' 3' TSS CTATAAAAATGCCATGCATTATCTAGATAGTAGGCTCTGAGAAATTTATCTCACT | | | | | | | | | | GATATTTTTACGGTACGTAATAGATCTATCATCCGAGACTCTTTAAATAGAGTGA - 5' PROMOTER TERMINATOR 3' a) Which strand (top or bottom) is the template strand? Explain why. b) What is the sequence of the mRNA produced from this gene? Label the 5' and 3' ends. c) What is the sequence of the protein produced from the mRNA? d) If a mutation (an insertion) were found where a T/A (top/bottom) base pair were added immediately after the T/A base pair shown in red, what would be the sequence of the mRNA? What would be the sequence of the protein?a) What is a mutation in molecular terms? b) a mutation deletes a base in the genomic DNA discuss how that will affect the reading frame and expression product production. Using the following list of codons describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be sure to discuss all steps. In other words, use a diagram and give me sequences, transcription and translation steps. Show the sequences of the sense and the other DNA strand, the mRNA and the tRNA’s. UUU -phenylalanine UCU -serine AUG –initiation/methionine CUU -leucine ACU -threonine GUU -valine UAA -Termination
- Using the following list of codons describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be sure to discuss all steps. In other words, use a diagram and give me sequences, transcription and translation steps. Show the sequences of the sense and the other DNA strand, the mRNA and the tRNA’s. UUU -phenylalanine UCU -serine AUG –initiation/methionine CUU -leucine ACU -threonine GUU -valine UAA -TerminationThis is a double-stranded DNA sequence—with no introns—that codes for a small protein (this is a hypothetical example: real genes are much longer and have introns). Transcription begins at the Transcription Start Site, which is the G/C base pair indicated by “TSS” and gold shading. Transcription stops at the A/T base pair marked with the arrow. (shown in image 1) 1)Which strand is the template strand for transcription? a)top b) bottom 2)What elements allowed you to identify the template strand? (Select all that apply) a)An ATG toward the 5' end ("upstream"} from the TSS b)The template strand has the 3' end on the left side. c) An ATG toward the 3' ("downstream") from the TSS d) The template strand is "read" by the polymerase from its 3' to 5' end. 3)What is the sequence of the mRNA transcribed from this gene? a) 5’GACAGACGAUGACAUCAUGCAAAUAAGAAUUUA3’ b) 5’CUGUCUGCUACUGUAGUACGUUUAUUCUUAAAU3’ c) 3’GACAGACGAUGACAUCAUGCAAAUAAGAAUUUA5’ d) 3’CUGUCUGCUACUGUAGUACGUUUAUUCUUAAAU5’ 4) Write the…Shown below is an eukaryotic gene. Assuming normal wild type RNA processing in a.cell, which of the following mature MRNAS could result in normal levels of functional synthesized proteins? Select all that apply Direction of transcription Promoter Template strand 5' Exon 4 Intron 3 Exon 3 Intron 2 Exon 2 Intron 1 Exon 1 3' 5' Coding strand Transcription start Transcription start 5' CAP-Exon1-Exon3-Exon4-AA..AAAA 5' CAP-Exon1-Exon2-Exon3-Exon4-AA...AAAA 5' CAP-Exon1-Exon2-Exon3-Exon4 Exon1-Exon2-Exon3-Exon4-.....AAAA