Assuming the average weight of a deoxynucleotide monophosphate (dNMP) is 327.0 g/mol, how many picomoles of DNA are present in 500ng of a 1000bp DNA fragment?
Q: The hormone, glucagon, is released in the body when glucose levels are low. Briefly describe how…
A: In response to changes in blood glucose levels, the pancreatic cells secrete two peptide hormones:…
Q: Uracil and Adenine are two nitrogen bases constitutive of RNA. Both compounds show maximum…
A: The Beer Lamberts equation relates the absorbance value given by an analyte for a particular…
Q: Give other chromatographic techniques that can be used for separating non-polar biomolecules, such…
A: Introduction: Chromatography is a method for separating a mixture in the laboratory. The mixture is…
Q: What type of rotational (cyclic) symmetry is apparent in the structure? O Six-fold. O Seven-fold. O…
A: SARS COV-2 belongs to the coronavirus family. It has many proteins that form the complete structure,…
Q: The lens of the eye si the light refracting medium of the eye, and ti has no mitochondria. Glucose…
A: "Since you have posted a question with multiple sub parts, we will provide the…
Q: (c) Outline how you would investigate whether BCMAP would be an effective inhibitor for the protein…
A: Inhibitors are the molecules that slow down or completely block the protein activity of molecules,…
Q: 10. Briefly describe and draw the structure of these polysaccharides based on glucose or another…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: Synthesized proteins are processed either inside the organelles or in the cytoplasm True False…
A: The proteins are constituted of twenty naturally occurring amino acids that are linked via peptide…
Q: 2. To track the insulin purification process, the ratio of insulin to total protein is tracked…
A: To study the physical and chemical properties of insulin, it must be separated from the mixture of…
Q: The unicellular fungus Saccharomyces cerevisiae is used in the food industry to ferment sugars. The…
A: In animals, Pyruvic acid has two possible fates in the cell: be oxidised into acetyl CoA and enter…
Q: The genetic code is said to be degenerate. This means that each codon codes for more than one amino…
A: INTRODUCTION: Genetic code - The genetic code is defined as the set of rules or instructions which…
Q: The glycolytic enzyme aldolase catalyzes the following cleavage reaction: Fructose 1,6-bisphosphate…
A: Aldolase is an enzyme that catalyses one of the reaction of glycolytic pathway by performing a…
Q: which of the following types of information is provided by a suffix? A) numbers b) positions…
A: Prefix, root word and suffix are used to define and complete medical terminologies. Prefix is…
Q: Is B monomer a beta fructose or alpha fructose. How do you know?
A: Cyclization of linear fructose can give us a furanose ring. Furanose is 5 membered ring . The 5…
Q: What specific qualities of ATP make it a useful energy currency?
A: Adenine, different phosphate groups, and ribose sugar make up the chemical molecule known as ATP.…
Q: In an enzyme-catalyzed reaction where enzyme concentration is held constant and substrate…
A: Enzymes are biological catalysts. They increase the rate of the reaction they catalyze. There are…
Q: How many electron(s) is/are required to completely reduce an oxidized cytochrome-c
A: Electrons generated during the oxidation of carbohydrates are carried by electron carriers such as…
Q: Consider a hypothetical metabolic pathway involving four enzymes to convert molecule A into molecule…
A: Allosteric enzymes are enzymes whose catalytic activity is regulated by an effector molecule that…
Q: In order to activate glucose for storage as glycogen, what must be added to each glucose? A)…
A: Glycogen is a branched glucose polymer that is used as an energy reserve in animal cells. The…
Q: What are the other abundant source of lipids aside from egg yolk. Provide details on how you can be…
A: Lipids are a type of organic molecule that contains fatty acids as their monomers. They are there in…
Q: Write schematically the synthesis of phosphatidylcholine from phosphatidylethanolamine. What…
A: Lipids are chemically diverse group that have two things in common: low solubility in water and high…
Q: Which of the following statements is INCORRECT? OA) The inhibition of phosphofructokinase leads to…
A: In the process of glycolysis, the six-carbon sugar glucose is divided into two molecules of the…
Q: Provide other techniques which can be used to characterize DNA extracts. Provide advantages and…
A: DNA extracts characterization is done by many methods. It is done to check purity, stability,…
Q: Question 16 Proteins imported into the nucleus are transported via which mechanism? tranlocational…
A: The proteins are constituted of twenty naturally occurring amino acids. The proteins have signal…
Q: Time (s) 200 180 160 140 120 100 80 60 40 20 0 0 Change in absorbance vs Time 0.05 y = 660.47x…
A: Change in absorbance per minute at any wavelength can be determined by using the ratio of…
Q: The Cori cycle involves the: OA) conversion of glucose to lactate in liver and lactate to glucose in…
A: The Cori cycle is also known as the lactic acid cycle. During muscular activity, when oxygen supply…
Q: Calculate length of tubes required for desired production rate
A: Proteins Proteins are the long chain of amino acids , they are essential for the structure,…
Q: In the synthesis of urea, one nitrogen atom comes from ammonia, the other comes from: ○ A) fumarate.…
A: The urea cycle (or ornithine cycle) is a cycle of biochemical reactions that produces urea from…
Q: Bile acids: localization of synthesis, their biochemical significance.
A: Introduction Cholesterol is a compound which is essential for our body. Cholesterol is synthesised…
Q: You are sequencing the following DNA molecule 3'- GACTACCGAAATTAT-5. Assume the annealing primer…
A: As per the Watson-Crick model of the DNA double helix: DNA is made up of two strands of…
Q: The AG of a reaction is positive. Which is TRUE? The cell cannot catalyze this reaction under any…
A: In a general reaction such as: A + B ⇌ C + D At equilibrium (steady state), the concentration of…
Q: 1. Describe how each of the following modes of analysis may be used to measure enzyme activity:…
A: Since you have posted multiple questions with multiple sub parts, we will provide the solution only…
Q: Application Of DNA fingerprinting 1. Look at the diagrams below and indicated if the child came from…
A: Electrophoresis means migration of charged particles under the influence of an electric field.…
Q: 1. Biochemical mechanisms of fatty acids and glycerol mobilization. 2. Metabolism of glycerol,…
A: Triglycerides are fatty acid esters of glycerol, where three fatty acid molecules are linked to one…
Q: Buffers in pharmaceutical and biological systems
A: The pH of a solution refers to the concentration of H+ ions in a solution. If the H+ concentration…
Q: 3. Prostaglandins (5) are derived from the 20-carbon fatty acid arachidonic acid in a reaction…
A: In order to solve this problem , we need to draw the Lineweaver Burk plot (LB plot). LB plot has…
Q: 2. Biosynthesis of cholesterol in the human body: 2.1. cellular and tissue localization of the…
A: Lipids are a chemically diverse group with two common characteristics: low solubility in water and…
Q: 3) Which statement explains a way in which a researcher could cause a cytoplasmic protein to…
A: process of transporting cytoplasmic proteins into the nucleus 1. cytoplasmic protein contains an NLS…
Q: An infant was admitted to hospital for failure to thrive. It was discovered that the infant lacks…
A: Saturated fatty acids undergo beta oxidation in the mitochondria. A fatty acids with 'n' carbons…
Q: Draw the L(leucine)-A(alanine)-E(glutamate) triple tide and calculate its isoelectric point.
A: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal amino acid on…
Q: Which of the following does NOT correctly describe the fluid mosaic model of lipid bilayer? A.…
A: Lipids are biomolecules that do not have a fixed chemical structure like carbohydrates or amino…
Q: What is misleading about the term hydrophobic bond? What drives the hydrophobic effect? How is it…
A: Introduction Hydrophilic molecules are water loving groups and are soluble in water. But…
Q: Question 13 1 The binding of seven molecules of ATP at the apical domain of the GroES causes the…
A: Since you have asked multiple questions, we will solve the first question (Question No. 13) for you.…
Q: B. Below is a short segment of a DNA molecule. Translate the DNA codon into mRNA. Use your data…
A: DNA conists of a double-stranded helix wound together by weak hydrogen bonds between…
Q: The carbon-carbon bond distance for single-bonded carbons, such as those in a saturated fatty acyl…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…
Q: Certain proteins undergo Post Translational Modifications (PTMs) with lipid derivatives such as…
A: Post-translational modification Post-translational modification is a process by which proteins are…
Q: All metabolic pathways must be regulated to maintain homeostasis. The catalytic activity of an…
A: Enzymes are biocatalysts that catalyse biochemical reactions. They contain an active site where the…
Q: Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA?…
A: The given sequence belongs to the XPA gene of humans. This responsible for nucleotide excision…
Q: Which of the following statements is NOT true of biological organic molecules? Their atoms are…
A: “Since you have posted multiple questions, we will provide the solution only to the first question…
Q: For the reaction 4 A + 5 B → 2C+ 3 D, what is the magnitude of the rate of change for [D] when [A]…
A: According to law of chemical kinetics, the rate of product formation is directly proportional to the…
Assuming the average weight of a deoxynucleotide monophosphate (dNMP) is 327.0 g/mol, how many picomoles of DNA are present in 500ng of a 1000bp DNA fragment?
Step by step
Solved in 3 steps
- One gram of cultured human cells contains about 10^9 cells and occupies roughly 1 mL. if the average molecular mass of a base is 660 daltons and each cell contains 6,4 *10^9 bp, what mass of DNA is present in this one-gram sample? If all the DNA molecules in the sample were laid end to end to form a single thread. Would it be long enough to reach from the Earth to the Moon (385.000 kilometers).There is one base pair for every 0.34 nm of DNA and the totalcontour length of all the DNA in a single human cell is 2 m.Calculate the number of base pairs in a single cell. Assumingthat there are 1014 cells in the human body, calculate the totallength of DNA. How does this estimate compare to the distance from the earth to the sun (1.5 * 108km)?One gram of cultured human cells contains about 109 cells and occupies roughly 1 mL. If the average molecular mass of a base pair is 660 daltons and each cell contains 6.4 x 109 bp, what mass of DNA is present in this one-gram sample? If all the DNA molecules in the sample were laid end to end to form a single thread, would it be long enough to reach from the Earth to the Moon (385,000 kilometers)?
- Calculate the weight in grams of a double-helical DNA molecule stretching from the Earth to the Moon (320000 km). Assume that the DNA double helix weighs 1 x 10-18 g per 1000 nucleotide pairs and that each base pair extends 3.4 Å weight:The figure shows that the average distance between base pairs measured parallel to the axis of a DNA molecule is 3.4 Å. The average molar mass of a pair of nucleotides is 650 g•mol-1. Estimate the length in cm of a DNA molecule of molar mass 5.1x109 4.0 .26 g•mol-1. cm Roughly how many base pairs are contained in this molecule? [4.0 784615 x base pairs CG G C OH TA Thymine Adenine H. H. OH CH2 N-H.......O CH3 H H N……·H–N HLH TA OH 0-P H2C CG G C H. CH2 Guanine H OH Cytosine ... H-N TA AT H' N.....H-N HLH N-H.......O H2C OH H -o. -P3D0 TA 0- OH H. -CH2 (b) The most common structure of DNA, which is a right-handed double helix. The two strands are held together by hydrogen bonds (a) Base-pair formation between adenine (A) and thymine (T) and between cytosine (C) and guanine (G). and other intermolecular forces.Amino acids have an average molar mass of 100 g/mol.How many bases on a single strand of DNA are needed to codefor a protein with a molar mass of 5x10^5g/mol?
- A typical bacterial DNA has a molar mass of 4 × 109 g m ol-1 . Approximately how many nucleotides does itcontain?The Tm of a DNA strand can be calculated by hand using the formula: (2 ℃)(?????? ?? ? + ?) + (4 ℃)(?????? ?? ? + ?) = ??℃ Using this formular, calculate the Tm for the following DNA sequence: [CTTTCACAGCCACTATCCAGCGGTAC] Note: This formula has several limitations and is not useful for sequences longer than 14 bp. Use the Internet search to find an online Tm calculator. Use this calculator to find the Tm of the above sequence. Using information from your search, identify three factors that can affect the Tm.if this DNA has a molecular weight of 1.20 ×108 Dalton which contains a head in a about 200 nm long. Calculate the length of the DNA assuming the molecular weight of a nucleotide pair is 600 Dalton and assume that the DNA is a B-form and that there are 10 base pair per turn which makes is 34 Å per turn. ( 1nm = 10Å)
- The figure shows that the average distance between base pairs measured parallel to the axis of a DNA molecule is 3.4 Å. The average molar mass of a pair of nucleotides is 650 g•mol-1. Estimate the length in cm of a DNA molecule of molar mass 5.1x109 g•mol-1. 4.0 cm Roughly how many base pairs are contained in this molecule? 4.0 7.1e6 X base pairs AT CG OH O-P=D0 G C TA Adenine Thymine OH CH2 N-H.......O CH3 H -N N..... G C H A Он C G G C TA AT OH CH2 Cytosine Guanine H. O.......H-N H H' H N…**H-N HLH O N-H..... H2C OH TA OH CH2 (b) The most common structure of DNA, which is a right-handed double helix. The two strands are held together by hydrogen bonds and other intermolecular forces. (a) Base-pair formation between adenine (A) and thymine (T) and between cytosine (C) and guanine (G).Assume the energy of hydrogen bonds per base pair to be 5.86 kJ•mol-1. Given two complementary strands of DNA containing 145 base pairs each, calculate the ratio of two separate strands to hydrogen-bonded double helix in solution at 319 K. ratio = .283What is the concentration of a DNA solution that absorbs 0.812 and 0.463 at 260 and 280 nm, respectively? Is the DNA solution considered to be good quality? Why or why not?