Agent Step 1 Step 2 Nucleophile, Nu: Guanosine Leaving group, Y Electrophile ✗, part retained 3'-site phosphate Agent Nucleophile, Nu: Step 1 Step 2 2'01 BPA 3'-OH exon 1 Leaving group, Y 3'OH exon 1 3'0M intron 1 Electrophile X, part retained 5'-site phosphate intron I and extron 1 PO3 with nuclectide? 3'-site phosphate extron (1 and 2) POS with nucleotice?
Q: G Which of the following amino acids is most unlikely to be present in a beta sheet? Lysine Valine…
A: Proteins show two types of secondary structural elements. They are1) Alpha helix and2) Beta sheets .…
Q: I need help with drawing Hydrogen bonding between two tripeptide: Ser-Lys - Ser. In my class, we are…
A: The peptide backbone has a zig-zag structure with the hydrogen and side chain bonded to alpha-carbon…
Q: For each of the following mRNA sequences predict the appropriate protein sequence: a.…
A: Genetic code refers to the instructions contained in a gene that instructs a cell how to make a…
Q: You are studying how your Lys-Val-Thr tripep de interacts with another pep de, which places an Asp…
A: Eventhough all ionizable groups have their characteristic pKa value, the pKa value of an ionizable…
Q: 2. a) Energetics of the electron transport. In the oxidative phase of oxidative phosphorylation,…
A: Standard change in Gibbs free energy ( ) of redox reactions can be determined , if we know the…
Q: You have expressed a protein of interest in E. coli cells for further study in the lab. The protein…
A: One possible purification scheme for the protein of interest might include the following steps:1.…
Q: Please describe what is a peptide bond? What is the significance of the amino terminus versus the…
A: Proteins are biomolecules which show great diversity in their structure and functions. Amino acids…
Q: Using the information given, determine the Kd for the binding of HABA to BSA. B= y-intercept (E…
A: Y=mx+b is the equation of a line that is not passing through the origin. In this equation, m is the…
Q: During metaphase of mitosis, a cell from this organism would have a) A single line of 3 chromosomes…
A: Mitotic metaphase is the stage in nuclear division where the chromosomes line up in a single line…
Q: 2) You are studying the tripeptide Lys-Val-Thr. a) Draw the full structure of the tripeptide…
A: Pepetides are composed of amino acids. Amino acids are biomolecules where a carbon atom (called…
Q: What is the purpose of adding hydroquinone? What is the purpose of washing the egg homogenate with…
A: Since you have posted multiple questions, we will provide solution only to the the first question…
Q: 5. Explain the difference between a centriole and a centromere
A: The objective of this question is to understand the difference between two key components of a cell:…
Q: Tube # 2 3 4 6 5. THE EFFECT OF TEMPERATURE Temp. Abs. 0°C N/A 0°C 25°C 25°C 37°C 37°C 70°C 70°C 10…
A: Changes in temperature can affect the enzyme in different ways. When the temperature of the system…
Q: 1) Provide a stepwise, arrow-pushing mechanism for the following transformation. You may use general…
A: The reaction in question involves a lysis reaction catalyzed by a lyase enzyme using the coenzyme…
Q: Draw the major organic product for the following reaction. 1. LiAlH ཝ་རི་-w;"", - CH3-C C-CH 2.
A: The reaction is an example of reduction reaction where both the functional group reduces into the…
Q: Sketch a typical enzyme kinetic curve of [S] vs. V. The maximum [S] should be about four times the…
A: In a typical enzyme kinetic curve, the substrate concentration, [S] is plotted along the x-axis and…
Q: Compare and contrast photosynthesis with oxidative phosphorylation.
A: Photosynthesis is the process by which green plants and algae synthesize sugars using the energy…
Q: The cell above is in a) Meiosis 2 b) Mitosis c) Meiosis 1
A: During anaphase II of meiosis:The sister chromatids, which were held together by cohesin proteins at…
Q: Produces Leaves the nucleus and goes to the... 7. Transcription and Translation---DNA: A A…
A: Piece's of RNA make amino acids, which make proteins and this process occurs in the Cytoplasm. m RNA…
Q: Genetics Q4
A: The objective of the question is to find the sequence of the opposite strand of a given DNA strand.…
Q: The presence of the MCS in the coding region also results in us being able to express inserts…
A: The Multiple Cloning Site (MCS) is a short segment of DNA containing many (multiple) restriction…
Q: To track cell growth and utilization of the limiting substrate in a bioreactor, the yield is…
A: S=Y(X0−S0)X−X0+S0Explanation:Lag Phase: The growth rate is zero (μ = 0) since there is no…
Q: Suppose a yeast enzyme performs this reaction: Glyceraldehyde 3 - phophospate (GAP or G3P) → 3- -…
A: Glycolysis is the metabolic pathway where glucose is catabolised into pyruvate with a net production…
Q: Draw the following amino acids linked by peptide bonds: a. aspartate b. lysine c. cysteine d.…
A: Amino acids are compounds containing carbon, hydrogen, oxygen and nitrogen. They are monomers or…
Q: A coal fire plant uses 1 kg of coal to generate 1000 kWh of electricity and emits 50 kg of CO2 and 5…
A: The objective of the question is to understand the relationship between the functional unit (FU) and…
Q: How does HbS aggregation occur in sickle-cell anemia? Place the steps in the correct order. Note…
A: Sickling is seen in sickle cell anaemia where haemoglobin inside the RBC cells sticks together and…
Q: Is the following process considered oxidation or reduction? a oxidation b reduction Fe²+ Feº
A: Oxidation and reduction are fundamental concepts in chemistry that describe the transfer of…
Q: (1) For 10 glycolytic reactions (1-10), refer to your textbook, answer the following questions in…
A: Glycolysis is a catabolic pathway that breaks down glucose into pyruvate molecules. This occurs in…
Q: Genetics 8 Q1
A: The question is asking to identify the type of chromosome rearrangement that involves two…
Q: Question 1: tRNA and amino acyl tRNA synthetases Part a: How many codons encode the amino acid…
A: Methionine is encoded by a single codon, AUG, which also serves as the start codon in protein…
Q: 6. Consider the heptapeptide DERHHKY. What is the overall charge of this peptide at pH 5 and pH 7.4?…
A: Amino acids are organic molecules that form the building blocks of proteins. They contain an amino…
Q: N - Leucine - Arginine - Proline - Aspartic acid - Methionine - C write the structure classify the…
A: Peptides are composed of amino acids that are bonded to each other via peptide bonds. The ionizable…
Q: Ala-Cys-Glu - Tyr - Trp - Lys - Arg - His - Pro-Gly NAZO Glu pka 4.15 SH Tyr RO 10.10 Draw Charges…
A: Proteins are essential biomolecules composed of amino acids arranged in four structural levels:…
Q: What is the energy charge for the cell with concentrations of [ATP] = 1.000 mM, [ADP] = 10.00 uM,…
A: The energy charge, EC of a cell can be calculated using the formulaEC = [ATP + (1/2 ADP) ] / (ATP…
Q: Determine the molecular weight of the protein glycogen phosphorylase which is composed of 842 amino…
A: Proteins are composed of around 20 standard amino acids. Amino acids have varying molecular weights,…
Q: 1) Provide a stepwise, arrow-pushing mechanism for the following transformation. You may use general…
A: The reaction in question involves a lysis reaction catalyzed by a lyase enzyme using the coenzyme…
Q: Genetics 8 Q4
A: The question is asking whether the process of meiosis, which is the division of a germ cell…
Q: 10. A new protein of unknown structure has been purified. Gel filtration chromatography reveals that…
A: From the given data, we can deduce the following about the protein's tertiary and quaternary…
Q: Propose structures for intermediates A and B in the scheme below. This three-step conversion is…
A: Citrate is isomerized to isocitrate in the citric acid cycle via dehydration and rehydration. These…
Q: Problem 2
A: The objective of this question is to identify the recombinant offspring from a genetic cross between…
Q: Part 1. In dilute acid, hexoses exist in equilibrium with the corresponding 1,6-anhydrosugars. For…
A: One or more water molecules have been removed from sugars, which are known as hydro sugars. One…
Q: Question 3
A: The question is asking about the structure of DNA and what parts of the DNA strands are connected by…
Q: Construct the two enantiomeric forms/structure of the following monosaccharides and designate the…
A: Monosaccharides are the simplest form of carbohydrates, often referred to as simple sugars. They…
Q: For a Michaelis-Menten reaction, k₁=5 x 107/M-s, k-1-2 x 104/s, and k2=4 x 102/ Calculate the Ks and…
A: According to enzyme kinetics k1 is the formation of the ES complex,k-1 is the rate of dissociation…
Q: Draw the major organic product of the following reaction. conc. KMnO4, heat
A: Answer is given below Explanation:
Q: Draw the dominant form(s) AND indicate the percent composition of each form of glutamic acid when…
A: Glutamic acid is an amino acid. Amino acids are simply an alpha-carbon bonded to 4 groups. The 4…
Q: The peptide below 요 H3N-CH- -NH- -CH- NH–CH=C -NH-CH-C NH–CH- C-OH CH3 CH2 CH2 CH2 CH HO-CH, CH2 C…
A: Peptides are produced from amino acids. The pH of the medium and the amino acid sequence determine a…
Q: What did experiments using porcelain filters prove?
A: The objective of the question is to understand the significance of experiments using porcelain…
Q: Provide a stepwise, arrow-pushing mechanism for the following transformation. You may use general…
A: The reaction in question involves a lysis reaction catalyzed by a lyase enzyme using the coenzyme…
Q: Proteases are one of the main drug targets. Choose the False statement regarding proteases. A.…
A: Proteases are a group of enzymes with a catalytic function to hydrolyze ( a reaction where water…
Question 2:
Part a: Complete the table describing different components of intron removal from mRNA. Nu:, X and Y refer to B-type chemistry shown on the previous page. (YELLOW table shown)
Part b: Complete the table describing different components of group I self-splicing intron removal from 26S rRNA in Tetrahymena. (BLUE table shown)
Part c: Draw the intron with an all atom structure for Branchpoint A after intron removal from mRNA
Part d: Draw the Group I self-splicing intron with an all atom structure for the Guanosine cofactor after intron removal from 26S rRNA in Tetrahymena.
Step by step
Solved in 1 steps
- Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?5' 3' ORF1 ORF2 ORF3 ORF4 ORF5 1. Above are pictured 2 operons, one that includes ORF1 and OFR2 and is transcribed using the top DNA strand as the template, and the other includes ORF3, ORF4, and ORF5 and is transcribed using the bottom DNA strand as the template. 3' 5' a) Complete this diagram by using arrows (4) to indicate the position and direction of the promoter(s). It doesn't matter if you draw the arrows above or below the ORFS as long as they are pointing the right way. b) Underline and label with "RBS" the ribosome binding site(s). c) How many different RNA molecules will be made from this region of DNA? d) How many different proteins will be made from this region of DNA? e) How many promoters are found in this region of DNA? f) How many stop codons are found in this region of DNA? g) What assay would you use to investigate the protein accumulation of these ORFs?#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
- #1 HindII --- 5’ GTC ↓ GAC 3’ 5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’ 3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:20:201 Foundations Cell Molec 48. The first 17 amino acyl residues in human preproinsulin are H₂N-MALWMRLLPLLALLALW-COOH and the encoding nucleotide triplets ("codons") in DNA are 5'-ATG GCC CTG TGG ATG CGC CTC CTG CCC CTG CTG GCG CTG CTG GCC CTC TGG-3'. Are these molecules written according to their colinearity? A) No. Colinearity is written C-N and 3'-5' for proteins and nucleic acids, respectively. Yes. Colinearity is written N→C and 5'-3' for proteins and nucleic acids, respectively. No. Colinearity is written C-N and 5'-3' for proteins and nucleic acids, respectively. D) There is no such a thing as colinearity. red by ribozymasRibosome-targeting antibiotics x 8 Tetracycline Antibiotics: Mode x D (3) The Nurse- du/d21/Ims/quizzing/user/attempt/quiz_start_frame_auto.d21?ou=5003190&isprv3&drc%3D0&qi%3D4975665&cfe self quiz ngel Kenkpen: Attempt 1 For each description, state if the gene expression will increase (1), decrease (2) or remain the same (3). Binding of the CAP protein to the lac operon promoter An enhancer sequence without at activator bound Binding of a repressor protein to an operator Increased glucose at the lac operon chromatin condensation Increased number of ribosomes on a single MRNA transcript (polyribosome) Binding of an activator
- Name each of the processes pictured: -RNA 5' TCAC CÁCTCAT 3' TACCACCTA 3' UUCAC CACUCAU U 5' DŇA RNA polymerase Primary RNA transcript Exon 1 Intron Exon 2 Intron Exon 3 Spliced RNA 000 Exon 1 Exon 2 Exon 3 AAAAAAA polypeptide chain Met Phe Arg P E UAC AAA GCU AUGUUUCGA Ribosome There are possible nucleotide "triplets" orMatch the components of bacterial replication and transcription correctly. v [Choose ] Topoisomerase Il helicase loader RNA polymerase must accumulate enough for DNA replication to begin Single stranded binding protein sigma factor proteins of the RNA polymerase adds nucleotides to RNA transcript DnaA bacterial helicase DNA gyrase - needed for recognition of promoter site in transcription Beta clamp DNA polymerase Tau complex two alpha units, beta, beta prime, and omega Dnac [ Choose ) DnaB ( Choose]Coding DNA 5’- GTG ACT CGT TGT GCC ATT GCA GCT AAA CAC TTC GAG CCC TGT- 3’ mRNA 5’- GUG ACU CGU UGU GCC AUU GCA GCU AAA CAC UUC GAG CCC UGU- 3’ What is the polypeptide sequence?
- 5’-GTCGTATAGTGA-3’ 3’-CAGCATATCACT-5’ if this is the dna sequence is the RNA sequence this 3’-GTCGTATAGTGA-5’, give reason if it not correctGive the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and with the correct 5' and 3' ends. DNA: 5'-ATAGGGCATGT-3' 3'-TATCCCGTACA-5' <--- template strand Group of answer choices 5'-ATAGGGCATGT-3' 3'-UAUCCCGUACA-5' 5'-AUAGGGCAUGU-3' 3'-TATCCCGTACA-5'pcc300ATAAADATATAOOTTAA 1. Use the genetic code table and the information in the diagram below to determine the amino acids that would make up the portion of the polypeptide shown. Include information for a key as well. DNA template 3' G CATA ACAGAGGATT-5' al bnsua AMAm pniwollot erfT E transcription s yd bnsita ebitgeqylog s sidmeaze of beae RNA strandUU UAOUOUU A-emoaodin 5'-CGUA AUUGUC UCCUUA- 3' J J JL erit o elinW (s) translation bluow terdt aspnso sigootiwsone polypeptide viemetis ns ebivo19 (d) ent ot etslanT Key: