A spherical cell with the diameter of 10uMhas a protein concentration of 20 mg/ml. Determine the number of protein molecules within the cell if the molecular weight of an average protein is 50,000 daltons (g/mol). Recall that Avogadro's number is N₁ = 6.0221367×1023 molecules/mol.
Q: Aristotle’s geocentric model of the solar system, despite its erroneous premise, would remain the…
A: The geocentric model, which posited that the Earth was at the center of the universe with the…
Q: 11. Using the information in the introduction on mutations and your knowledge of proteins, develop a…
A: The gene provides instructions for making a protein called the melanocortin receptor that is :-…
Q: Question 18 When a patient is said to have "second-degree burns," this indicates that the patient…
A: The question is asking about the characteristics of second-degree burns. It's important to note that…
Q: Myeloperoxidase staining activity decreases as cells mature. Question 1 options: True…
A: The question is asking whether the activity of myeloperoxidase, an enzyme found in neutrophils and…
Q: explain: infectious pathogens distrubtion with the use of articles
A: The objective of this question is to understand how infectious pathogens are distributed and how…
Q: All of the following are TRUE of a vertebrate whose blood flows directly from the respiratory organs…
A: The question is asking us to identify the incorrect statement about a vertebrate whose blood flows…
Q: (a) Insert the table with data for Experiment 1 Table 1. Osmosis in a model cell…
A: Solution concentration is a measure of the amount of solute that is dissolved in a given quantity of…
Q: 7:09 PM Wed Apr 10 Three strains of green-seeded lentil plants appear to have the same phenotype.…
A: PART F- The answer is yellow-seeded. To determine the phenotype of the F1 progeny resulting from…
Q: For Krebs Cycle(Citric Acid Cycle) what are steps of cellular respiration for both aerobic (oxygen…
A: Respiration is a kind of combustion where food is broken down to produce energy. This can be of two…
Q: From DNA to Protein 3D what is the location in the cell or organelle where these processes occur,…
A: The process of protein synthesis, which involves the conversion of DNA to protein, occurs in two…
Q: Phytoremediation is the utilization of plants in the clean up of a polluted area. Are Indian…
A: Approach to solving the question: Detailed explanation: Examples: Key references: Biology
Q: As I am taking the counterpart of this course, Anthro 101, I needed the lab in addition so it would…
A: Approach to solving the question: Answer is based on the instruction provided. Detailed explanation:…
Q: -Centromere D D Ø ☹ A B ℗ ℗ D E C
A: The objective of the question is to determine the chromosomal condition of a daughter nucleus at the…
Q: Huntington’s Disease is a dominant lethal disease that manifests later in life after many people…
A: When individuals are able to gain an understanding of their genetic status, they are able to utilize…
Q: Are there any treatments for Jacobsen Syndrome? What are the possible health outcomes for a person…
A: Jacobsen Syndrome, also known as 11q deletion disorder, is a rare genetic disorder that results from…
Q: 3 Compound A is an optically active mixed triglyceride, for which the following apply: a) contains…
A: ### Triglycerides and Fatty AcidsTriglycerides are esters derived from glycerol and three fatty acid…
Q: 7:09 PM Wed Apr 10 Three strains of green-seeded lentil plants appear to have the same phenotype.…
A: Part C: It is suggested that one gene with two alleles (dominant and recessive) is segregating by…
Q: Why does hepatitis D only occur in patients with hepatitis B?
A: 1. Dependence on HBV for Replication: Hepatitis D virus (HDV) is a defective RNA virus that lacks…
Q: What differences do you notice between the male and female forms of extant apes?
A: Extant apes are the apes that are still alive today. There are six extant ape species: gorillas,…
Q: I have a vial of F2 offspring resulting from a two-generation cross between true-breeding wildtype…
A: Approach to solving the question:To determine the expected numbers, I applied Mendelian genetics…
Q: I have a vial of F2 offspring resulting from a two-generation cross between true-breeding wildtype…
A: Approach to solving the question:I derived the expected number of fruit flies by applying Mendelian…
Q: Which of the following is NOT an adaptation among plants to increase access to nitrogen?…
A: Mutualistic association with fungi that convert atmospheric nitrogen into a biologically available…
Q: Do the cells migrate to new locations during development and form selective adhesions with other…
A: Amid the early stages of development, cells alter a lot. They not only do diverse things, but also…
Q: Choose all items that regulate the transcription of mRNAs.Group of answer choices A. Transcription…
A: The objective of the question is to identify the elements that regulate the transcription of mRNAs.
Q: Match the problems for biodiversity with the solutions. Train more scientists.…
A: (1) For the problem "Ecosystems lack monitoring", the solution is to "Train more scientists."This…
Q: Gel Electrophoresis A. Why does DNA travel toward the positive electrode in the gel chamber? B. What…
A: Approach to finding a solution to the problem:1. Have a solid understanding of the fundamentals of…
Q: < 4:04A March 22 3:13 PM Edit Question 7 The electron transport chain of chloroplasts is located in…
A: QUESTION 7Certainly! The location of the electron transport chain (ETC) in chloroplasts can be…
Q: DNA cloning refers to a. making cloned bacteria. b. making cloned sheep or other eukaryotic…
A: Sure! DNA cloning involves the creation of exact copies of a particular DNA fragment or sequence.…
Q: -Centromere D D Ø ☹ A B ℗ ℗ D E C
A: The objective of the question is to understand the chromosomal condition during the prometaphase…
Q: You cross two wildtype (short-tailed) chipmunks, and collect a male offspring with a particularly…
A: Approach to solving the question: Detailed explanation: Examples:aApproach to finding a solution to…
Q: 23
A: The question is asking us to identify the biological process that allows different RNAs to be made…
Q: Which of the following metabolic tests would only be performed on Gram-positive bacillus? VP TSIA…
A: The objective of the question is to identify which among the given metabolic tests is specifically…
Q: Theophrastus of Lesbos, Aristotle’s successor as head of the Lyceum, improved upon Aristotle’s…
A: Monocotyledons (monocots) are flowering plants with a single embryonic seed leaf (cotyledon). They…
Q: Briefly describe the overall message of figure 1C
A: Figure 1C presents a detailed depiction of the gene network associated with the gastrointestinal…
Q: If 80% of drunk drivers fail to pass a sobriety test (walking a straight line for 5 meters) in 60…
A: The objective of the question is to determine the specificity and sensitivity of a sobriety test…
Q: 3:10 1 < Back Pulse Question 53 (Mandatory) Of the big mass extinctions the planet has faced, which…
A: Detailed explanation:For number 53.:Correct answer: b. Anthropocene According to a proposed…
Q: I have a vial of F2 offspring resulting from a two-generation cross between true-breeding wildtype…
A: b) Pink body color females:Expected number = Total number of flies * Probability of being pink= 120…
Q: Which of the following is NOT secreted by the pancreas?
A: The pancreas is a glandular organ in the digestive system and endocrine system of vertebrates. It is…
Q: D Question 2 Name the specific tissue type that would serve as the "binding material" between a…
A: The objective of the question is to identify the type of tissue that acts as a 'binding material'…
Q: 17
A: The question is asking about the possible outcomes of alternate splicing of a gene that has 6 exons.…
Q: What do you notice about the eyes of new world monkeys? Are they active during the day or night?
A: New World monkeys, a diverse group of primates found in Central and South America, are known for…
Q: 18
A: DNA sequence 5'ACCTGTGCAATATACGGCCAT3'3'TGGACACGTTATATGCCGGTA5'mRNA5' ACCUGUGCAAUAUACGGCCAU 3'Amino…
Q: In Aristotle’s scala naturae, the entoma (insects, chelicerates, and other non-crustacean…
A: The objective of the question is to understand the classification of 'souls' that Aristotle assigned…
Q: FREQUENCY 60 40 20 0 88842 140 120 100 80 1 3 5 7 9 11 LITTER SIZE 13 15 Which of the following best…
A: Both k and r are strategies for survival. In k selected small number of offspring is produced with…
Q: Allowing all drunk-driving suspects (driving erratically) to complete the above sobriety test in 120…
A: The question is asking about the potential effects of extending the time allowed for a sobriety test…
Q: https://journals.lww.com/acsm-essr/Pages/issuelist.aspx You will need to access the journal website…
A: A randomized experiment was conducted to investigate the effects of early physical exercise therapy…
Q: part ii: Calculate the Shannon-Weiner index and Simpson’s index of diversity for each island.
A: To solve the question, you can follow these steps: Calculate Gamma Diversity ( � γ): Use the…
Q: Please help! Research and describe a rapid antibody test used to detect a disease. Answer the…
A: Name of test: HIV Self-Test (various brands available)There are numerous brands of HIV self-tests…
Q: E. coli strain BW25113 can grow on (D) Arg as the sole carbon source. A scientist working with you…
A: Obtain the genomic from the mice cells that encode for the protease of interest.Fragment the…
Q: A baby born 3 days ago presents to the peds clinic slightly jaundiced. The baby is drawn to…
A: The objective of the question is to determine whether the mother should have been given Rhogam 3…
Step by step
Solved in 2 steps
- A spherical cell with the diameter of 10uMhas a protein concentration of 20 mg/ml. Determine the number of protein molecules within the cell if the molecular weight of an average protein is 50,000 daltons (g/mol). Recall that Avogadro's number is NA 6.0221367×1023 molecules/mol. =Protein concentration can readily be determined using the Beer-Lambert law: A = e l c where A = absorbance e = molar absorption coefficient (M-1cm-1) l = light path length (cm) c = concentration (M) If the molar absorption coefficient at 280 nm for yeast ADH is 48860 M-1cm-1 and a 10 mL solution of the protein has an absorbance at 280 nm of 0.4 (as measured by a spectrometer with pathlength 1 cm), then what is the concentration of the protein solution (in μM)? i.e. concentration = ______ μM If the molecular weight of the protein is 36849, what is its concentration in mg/mL? i.e. concentration = _______ mg/mL For each part of the question, show your calculations to arrive at your answers.2. 0.1 mL of a protein solution of concentration of 7 mg/mL was diluted to a total volume of 4.0 mL with water (i.e. 0.1 mL of the solution was added to 3.9 mL of water). 3 mL of this solution was then mixed with 27 mL of water. What is the concentration of the diluted protein solution? Space to show your workings:
- The A280 of a protein sample loaded onto a gel was determined to be 0.767 (1.00 cm path length, after subtracting the blank). The total volume of this sample was 428 µL. 19.0 µL of this protein sample was mixed with 19.0 µL of 2X laemalli sample buffer and then 12.0 µL of the entire sample was loaded into the gel and electrophoresed. Calculate the amount of protein that was loaded into the gel (in µg).Give only typing answer with explanation and conclusion You want to make 94 µL of the diluted Cell-Free extract for estimation of total protein. To do this, how much water will you add to the correct volume of the undiluted cell-free extract? Note: Cell-free extracts will need to be diluted 1:25 in water.A protein required 6.8 min to travel 82 cm to the detector in a 96 cm -long capillary tube with 25.4 kV between the ends. Find the apparent electrophoretic mobility. How many femtomoles of 2.4 μM protein are injected electrokinetically into a 50 μm diameter capillary at 5.0 kV for 3.0 sec. if the sample has half of the conductivity of the background electrolyte.
- 6-73 In each case, tell which side (if either) rises and why. The solvent is water. A A Osmotic membrane (a) 1% glucose (b) 0.1 M glucose (c) 1 M NaCl (d) 1 M NaCl (e) 3% NaCl (f) 1 M NaBr (B) B 5% glucose 0.5 M glucose 1 M glucose 1 M K₂SO4 3% KC1 1 M KC1Does this calculation look correct? My goal isto have a target mass of 10 µg of my protein with a total volume of 30 µl. Protein was measured and found to have a concentration of at 308.35 µg/ml Recall, mass = concentration * volume 10 µg = 308.35 µg/ml * V V = 0.01 mg/ 0.30835 mg/mL = 0.032430679 mL = 32.43067942 µL Note: cannot measure this amount; two dilutions required. Dilute by 1/40: measure 2.5 µl of protein at 0.30835 µg/µl and add it to 97.5 diluent to prepare a solution of protein at 7.71 mg/ml. This diluted sample will be used further. Mass = concentration * volume 10 µg = 7.71 mg/ml * V V = 0.01 mg/ 7.71 mg/ml = 1.3 µL Therefore, will measure 1.3 µl of protein at 7.71 mg/ml and add it to 28.7 µl of diluent.Polymer beads (resin) made of DEAE (diethylaminoethyl) cellulose are packed in an ion exchange column. The total mass of beads in the column is 8.47 kg. On average, each bead weighs 0.0023 g and has an average of 18.4 * 10° positively charged amine groups that can adsorba negatively charged protein that passes through the column. A solution containing 2.07 mg/L of a protein is maintained at pH 6.3 and is passed through the ion exchange column at 0.215 L/min. The protein has a molecular weight of 154,000. The pk, of the amino groups on DEAE cellulose is 7.1, and the pl of the protein is 5.6. 2. A. How long can the column be operated before reaching 80% capacity (i.e., 80% of the amino groups on DEAE are bound to the protein through an ionic bond)? You may assume that one protein attaches to one + charge on the beads (although it's possible that proteins attach to more than one + charge). B. After reaching 80% capacity, explain what you would do to release the protein attached to the…
- Consider the following protein mixture: Protein A B C D Molecular Weight (kDa) 50 150 200 350 Affinity to Metal ion === Zn²+ === 1. Using hydrophobic interaction chromatography, the protein that will be eluted last is [Select] 2. Using affinity chromatography, the protein that will be eluted last in a Zn²+-containing column is 3. The protein with the fastest migration towards the anode in SDS-PAGE is [Select] IpH value 7 3 9 5 [Select] [Select] 4. Using a buffer solution with a pH of 4, the protein that will bind to an anion exchanger is 5. The protein that will be eluted last in a gel filtration column is [Select] 6. Using isoelectric focusing, the protein that will have a protein band nearest to the cathode (negative electrode) is [Select] % Hydrophobicity 20 45 75 555/ n SO a- 6.46 The following data show the binding of Mg2+ ions with a protein containing n equivalent sites: [Mg2+ ] total/μM [Mg2+ ]free/μM 108 Com 35 180 65 288 501 115 248 752 446 Apply the Scatchard plot to determine n and Ka. The protein concentration is 98 µM.A large chaperone protein complex GroEL is approximately 16 nm in diameter. When it is dissolved in water at 300 K, estimate the average time it will take for GroEL to diffuse a distance of 500 nm (0.5 micron). The viscosity of water is 10-3 Pa*s.