(a) A pathway consists of 6 enzymes (p, q, r, s, t, u) that convert substrate J to product X at a rate of 10 moles/hour. If enzyme q is increased from 5 mmoles to 35 mmoles the amount of product X increases to 20.5 moles/hour. What is the flux control coefficient for enzyme q (C¹)?
Q: Which monosaccharide(s) seen below is(are) an epimer of the structure on the left? H- НО Н- H CHO О…
A: Two isomers that are correlated to one another by reflection are called optical isomers or…
Q: 13. Southern blotting is separation of DNA by agarose electrophoresis and probing with a labeled…
A: The 'blot' in the different blotting techniques (southern, northern, western and eastern blotting)…
Q: Complete the balanced equation for the overall reaction by selecting an answer choice in the…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence…
A: Genetic information in our body is stored in form of DNA. DNA multiples itself by replication. DNA…
Q: A structure of tyrosine is given and I need to draw the structure for neutral solution, pH 2 and pH…
A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group that is…
Q: Experiment: DNA Extraction from Banana The procedures are attached below. Question: 1. Will the…
A: DNA is the genetic material that is presented inside the nucleus of every cell. Banana is the best…
Q: Questions 11-13- refer to the carbohydrate mannose (open chain and one anomeric ring configuration…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: 1. Determine the molecular properties of amino acids; - what happens to the protein folding pattern…
A: "Since you have asked multiple questions, we will solve the first two questions for you. If you want…
Q: Which of the following occurs during the second round of the Q cycle (oxidized coenzyme Q =…
A: The Q cycle shows the sequential oxidation and reduction of CoQ, between the ubiquinol and…
Q: How does ATP regulate the activity of PFK-1? ATP binds to PFK-1 at the catalytic site as a…
A: The enzyme phosphofructokinase 1 (PFK-1) catalyzes the following reaction: Fructose 6-P + ATP –>…
Q: Maargerines made from plant oils are healthier, since they are hydrogenated for spreadability?…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…
Q: human cannot digest stachyose. Why?isn‘t it true that human do have aplpha galactosidase to break…
A: Some carbohydrates cannot be broken down in the small intestine by human enzymes. Raffinose and…
Q: Why might a person who is gravely ill not want to participate in a placebo-controlled drug study?
A: Placebo-controlled drug study is a study done where one group of participants are given the actual…
Q: Which one of the statements below best describes the mechanism of proton translocation by the…
A: The Q cycle (named after quinol) is a set of reactions. The Q cycle describes how the sequential…
Q: A 6-year-old boy is brought to the physician by his mother because of intermittent upper abdominal…
A: INTRODUCTION : Serum Chylomicron & its increased concentration - For the transportation of…
Q: In cardiac muscle cells, the sodium-calcium exchanger maintains a low Ca²+ concentration in the…
A: When we consider an ion, say A, moves from inside a membrane to the outside, the free energy of the…
Q: What do you call the test used to detect the presence of protein in saliva?
A: Proteins are high molecular weight biomolecules. They are polymers of amino acid residues linked to…
Q: 3- True or False: A given reaction, such as the hydrolysis of ATP can do a set amount of…
A: Adenosine triphosphate, or ATP, is a small molecule. It can be viewed as the primary energy currency…
Q: One of the molecules listed below is effective in reducing O2 affinity of human Hb in the absence of…
A: Hemoglobin is a globular protein, ie it is roughly spherical. It is a tetramer of two types of…
Q: 2. The lipids: a. They are found in high concentrations in cells in free form. b. They have one or…
A: DISCLAIMER FOR MULTIPLE Since you have asked multiple question, we will solve the first question…
Q: Efficascent Oil liniment formulation
A: Efficascent Oil liniments are oils that are topically applied to relieve muscle pain, joint pain,…
Q: The following carbohydrate is classified as a(n): CH2OHCHOHCHOHCHOHCHOHCHO O ketohexose O…
A: Monosaccharides are the simplest carbohydrates. They are classified into two based on the functional…
Q: When the citrate cycle is inhibited, which two metabolites are exported to the cytosol for fatty…
A: Citric acid cycle - it is also called as Krebs cycle or the TCA cycle (tricarboxylic acid cycle)…
Q: The word root erythr/o means?
A: INTRODUCTION : Word roots in medical field - In the field of Medical science , a different and…
Q: Defects in the Citrate Cycle are rare but have been described. Based on the level of metabolites…
A: Glycolysis consists of 10 enzymatically catalysed reactions that convert one 6-carbon molecule of…
Q: When a product inhibits an enzyme by binding to the active site, which of the following would occur?…
A: Introduction Enzymes are known as biocatalyst. They increases rate of a chemical reaction by…
Q: Describe how the results of carbon-14 labeling experiments demonstrated that the citrate cycle is a…
A: The citric acid cycle involves the oxidation of acetyl-CoA into carbon dioxide and water. It is the…
Q: Which of the following statements about gluconeogenesis is TRUE? Gluconeogenesis is one way to…
A: The term "gluconeogenesis" describes a collection of metabolic processes that take place in the…
Q: Arrange the following in the order they appear in electron transport. a. FAD, coenzyme Q, cytochrome…
A: Electron transport chain is a chain of electron carriers present in the inner mitochondrial…
Q: LO43 Identify the levels at which gene expression can be regulated in prokaryotes and eukaryotes…
A: Gene regulation is the process of control of expression genes. This process occurs by several…
Q: Which of the following is considered an omega-6 fatty acid?
A: Since animals cannot synthesize omega-6 and omega-3 fatty acids, they must be obtained from their…
Q: The sequence of part of an mRNA transcript is What is the sequence of the DNA coding strand? 5'- 5'…
A: DNA is double stranded & during replication both of its strands unwind to produce single…
Q: Which reaction or reactions of glycolysis require NAD* as a reactant? Which reaction or reactions in…
A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…
Q: 1. Determine the Michaelis-Menten parameters of Vmax and K for the reaction S+E E.S₂E+S E.S E.S+W…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: 21. _____________________________________ adds acyl groups to two carbons of the backbone of…
A: Triacylglycerol (TAG) are compounds which has 3 acyl groups attached to a glycerol molecule. Fatty…
Q: Consider a protein with two surface-exposed histidine residues: HisA is a “typical” histidine…
A: The Henderson-Hasselbalch Equation for the deprotonation of a species is given below. pH= pKa +…
Q: CH3C(double bond with O)COO- (aq) + H2O(l)⇌ Pyruvate, a product of glucose metabolism Express your…
A: Glycolysis is the collection of 10 enzymatically catalysed reactions that oxidises a 1 molecule of…
Q: 2. Draw the structure of the fatty acid, 16:247,10, as it occurs at pH 7. Make sure double bonds…
A: Fatty acids can be named and numbered in 2 ways. Fatty acids have a carboxylate end (COO- ) and a…
Q: The citric acid cycle is shown. The methyl carbon in acetyl CoA is labeled with C14C14 (shown in…
A: Carbon tracing is a biochemical technique of tracking the path taken by a specific carbon atom in a…
Q: What is the role of HCO3 in the activity of pancreatic enzymes? 2. What factors are needed in the…
A: DISCLAIMER FOR MULTIPART Since you have posted a question with multiple sub-parts, we will solve…
Q: Be able to describe how the “law of mass action” drives bicarbonate formation when the blood is in…
A: In a reversible reaction such as: aA + bB ⇌ cC + dD At equilibrium (steady state), the concentration…
Q: 3. After 24 hours of fermentation, no more CO₂ was produced in the presence of sucrose. Assuming…
A: Yeast performs alcoholic fermentation. Alcoholic fermentation is the process by which certain sugars…
Q: Muscle glycogen phosphorylase, an enzyme that provides glucose to the muscle for energy production,…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Which of the following is a second messenger that ultimately causes inhibition of glycogen synthase?
A: Glycogen synthase - is a key enzyme of glycogenesis and also called as UDP- glucosyltransferase. GS…
Q: In an immunoassay, antibodies used to recognize and bind to antigens are called primary antibodies…
A: Immunoassays are used to detect the presence of an antigen (or even an antibody). Primary…
Q: The initial velocities of two different enzyme-catalyzed reactions were measured over a series of…
A: Michaelis Menten postulated that free enzyme reacts with the substrate reversibly to form an…
Q: In an enzyme mechanism that generates a negative charge in the transition state, which of the…
A: When a substrate(S) binds to the active site of an enzyme(E), it leads to the formation of an ES…
Q: Choose the correct answer from the options in brackets. The [positive/negative] standard…
A: Biological oxidation-reduction reactions involve the transfer of electrons from one biomolecule,…
Q: Considering that regulation most often occurs at irreversible steps in a biochemical pathway, which…
A: Enzymes are usually protein molecules which catalyze several biochemical reactions in our body…
Q: What would be the effect of a visualizing agent on the retention factor. Rf? A.Higher Rf B.Lower RF…
A: Visualising agent: The chemical agents that can be used to detect the number and location of the…
Step by step
Solved in 2 steps
- SPS Date: Page No. A pulse af 13-14c] of pyruate con tans 4c) js methylgiaup. added toa do0lated mitachondria. Prruiate (the 'Riuspension of solated mitochondoria Aften (Q ane tuen of c gcid cycle, which canlion co e (ore) labeled in Daaloocetate? he citri'c loore) labeledin Draw f caid crle infermedictes t shau hene the labreled the structures ALL the cetrec tohone canban ie ih erch one. (t How needed to nelecse caribon many tong the Gycle would te Eycle,Wou all the labeled as 1"cog? Explain your answer.HBY-BIO-U2-TEST BIOCHEMISTRY-SY 20-21 Which statement BEST explains why enzymes bind to specific substrates? O Anenryme can be inibted se ds active site is altered An enzyme faids ditterently in the presence of diferent substrates O Diferert amino acd seguences cause variations in the shapes of an enzymes active sites O Enzymesubstrate binding is based on sze so ony large enrymes can bind to large ubstrates23 Which statement describes a disease state caused by altered protein structure? A silent mutation in hyaluronidase disnupts mucosal function OA slent mutation in arachidonic acid disrupts eicosanoid production O A missense mutation in heokinase disrupts glycolysis OA ronsense mation in ATP disrupts energy metabolsm
- AM Fri May 21 Take Quiz Coenzymes function to O denature the enzyme, stopping the chemical reaction from occurring. interact directly with enzymes, either enabling the reaction to occur or making the substrate-enzyme interaction more efficient. O change the shape of enzymes, allowing different additional substrates to bind. O dilate blood vessels, allowing more blood to flow, allowing more substrate to reach enzymes. O absorb excess hydrogen and hydroxide ions, keeping the pH relatively stable, so that reactions can occur most efficiently. Question 11 1 In the digestive system, which major organ starts the breakdown of proteins? O Mouth O Large intestines O Small intestines O Stomach O Esophagus Question 12 energy is energy found in the bonds of ingested nutrients.BSC1010C Enzymes & Cellular Regulation Dr. Harris 4. Compare the rate of the pepsin-catalyzed reaction at pH = 1.5 with the rate of the lipase- catalyzed reaction at pH = 1.5. 5. Compare the rate of the pepsin-catalyzed reaction at pH = 8.0 with the rate of the lipase- catalyzed reaction at pH = 8.0. 6. Based on your understanding of protein structure, explain in detail the effect of exposing an enzyme to a pH outside its optimal range. Include a discussion of the effect on both the structure and function of the enzyme. 7. At what pH values is lipase likely to be denatured? Explain your answer.O Login - Sr Cycle - 4447214 A @ Tools Add-ons Help Last edit was 2 hours ago al text Arial 12 BIUA 2 wwww p gr I| 3 I 4 5 | 6 13. This new compound with one fewer phosphate groups is called adenosine diphosphate (ADP). What does the prefix "di" mean? 14. Compare the structural formulas of ADP and ATP and complete the table below, ATP ADP Number of ribose molecules Number of adenine molecules Number of phosphate molecules Which one is formed when ATP loses a phosphate group? Mark only one box. WHich one is formed when ADP gains a phosphate group? Mark only one box. Part IlI: Changing ADP to ATP DELL
- >MK585652.1 Sardinella tawilis voucher TaSt3 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial GGTGCTTGAGCAGGGATAGTAGGGACTGCCCTAAGTCTCCTAATTCGGGCGGAGCTAAGCCAGCCCG TTTCTTCATAGTGATGCCAATTCTAATTGGGGGTTTTGGGAACTGGCTCGTCCCTCTAATGATCGGGGC TTCTCCTAGCCTCTTCGGGCGTAGAGGC GGGCAGGGACGGGTTGAACAGTATACCCGCCCTTGGO ATCTCGTCAATTCTTGGGGCGAT ACCACAATTATTAATATGAAACCCCCTGCAATT CAGTCCTGGCTGCCGGGATCACTATGCTATTAACAGATCGAAACTTAAATACAACTTTCTTCGACCCTGCAGGAGGAGGAGACCCAATTCTATACCAACACCT The highlighted text refers to the Gene origin Gene identity Accession number O Species identity GGACGACCAGATTTACAACGTCATCGTCACGGCACATGCCTTCGTAATGAT TCCCGCGAATAAACAACATGAGCTTCTGGCTCCTTCCCCCTTCCTTCCTTC of the sequence? SGGGCCTCTGTCGACCTTACCATCTTCTCACTCCACCTAGCAGGT TTGAGCTGTTCTCGTAACCGCTGTGCTTCTCCTTCTCTCCCTTCxplain the most important ceason whiy enzymer are necescary in anchemical feactions.enzyme active site Ser-CH₂-C 195 Asp 102 substrate 15. A substrate binds to enzyme active site. a) List the roles of serine, histidine and aspartic acid b) Show how the first tetrahedral intermediate would be formed. c) Show acyl-enzyme intermediate. d) What is the pka for Histidine? How is this pka relate to physiological pH (7.4)? Do you anticipate any enzymatic reaction will occur if histidine is replaced with cysteine? Why?
- 12 Avdil DiC diLei OcL 27 dl 1.Jopm nents Enzyme Reaction Rates ts prary racker 10 20 30 40 50 2 4 6. 8. 10 Temperature (°C) pH Based on these data, this enzyme functions best at what temperature and pH? Remind O Temperature of 27°C and a pH of 4 O Temperature of 40°C and a pH of 8 Four O Temperature of 50°C and a pH of 10 Calculator O Temperature of 37°C and a pH of 6urses / MEDBAS145en 21-22Spring / 2021-2022 Spring Semester / Final Which of the following pairs depict the absolute specificity of the enzyme? Select one: O O O O a. All of them b. Hexokinase - Glucose c. Lactase - Lactose d. Lipase - Triacylglycerol3:43 ll LTE O moellim.riphah.edu.pk Biochemistry-l Dashboard / My courses / Biochemistry-II | General / QUIZ 1 Question 7 Not yet answered Marked out of 1.00 P Flag question ADP will the regulatory enzymes of TCA cycle? Select one: O a. None O b. Both depending on condition O c. Inhibit O d. Activate Next page Course Outline