7. A portion of the nucleotide sequence from the DNA coding strand of the chick ovalbumin gene is shown. What is the partial amino acid sequence of the encoded protein? CTCAGAGTTCACCATGGGCTCCATCGGTGCAGCAAGCATGGAA-(1104 bp)-TTCTTTGGCAGATGTGTTTCCCCTTAAAAAGAA
Q: Assess the role of redox electron transfer in the formation of an electrochemical proton gradient…
A: Aerobic catabolism of 1 molecule of glucose can produce 10 NADH (6 from acetyl CoA in the TCA cycle…
Q: Dihydrofolate reductase is used twice for the reduction of folate to tetrahydrofolate. 2.…
A: Enzymes are high molecular weight proteins that catalyse biochemical reactions. Sometimes enzymes…
Q: 6. A portion of a gene is shown below. 5'-ATGATTCGCCTCGGGGCTCCCCAGTCGCTGGTGCTGCTGACGCTGCTCGTCG-3'…
A: mRNA, or messenger RNA, is a type of RNA molecule that plays a central role in the process of…
Q: 1. Hexokinase and Glucokinase are two enzymes that catalyze the first reaction of glycolysis:…
A: Hexokinase and glucokinase are iso-enzymes which is involved in the first step and rate-limiting…
Q: A diet deficient in folic acid is highly unlikely since folic acid is found in almost all foods.…
A: A diet deficient in folic acid can have serious health consequences. Folic acid, also known as…
Q: A. Draw the structure of the following peptide sequence at pH 2.0: ASP-ALA-THR-LYS-GLY B. What is…
A: Amino acids are basic building blocks of polypeptides, and one or more of these polypeptides they…
Q: What is the abbreviated name of the human gene that contains the CAGATTGTGAAGAGGTCTCTTGA? following…
A: Nowadays there are various tools that are used in bioinformatics to find out the gene from the gene…
Q: 1. 2. 3. Why does casein precipitates upon the addition of acetic acid? Why is milk used as an…
A: 1. Casein is stable in a solution, at pH values close to 7. This is because at this pH casein…
Q: What type of rotational (cyclic) symmetry is apparent in the structure? O Six-fold. O Seven-fold. O…
A: SARS COV-2 belongs to the coronavirus family. It has many proteins that form the complete structure,…
Q: 1.a)Which one of the following diseases is caused by an iodine deficiency? pellagra goiter night…
A: Iodine deficiency is a condition in which the body does not have enough iodine to produce thyroid…
Q: Cow's milk allergy (CMA) and lactose intolerance both result from dietary exposure to cow's milk and…
A: Proteins are high molecular weight polymers of amino acids that serve diverse functional roles in…
Q: Given the lipid structure below, part A was derived from __________ while part B was derived…
A: Glycerophospholipids have a structure similar to triacylglycerides, except that they are polar. They…
Q: 2. The amino acid side chain residues in an a helix point center of the helix. A) Outward B) Inward…
A: Proteins have four level of structures. Primary structure Secondary Structure Tertiary Structure…
Q: To completely reduce an oxidized cytochrome-c, how many electrons are required?
A: The electrons transport chain is a collection of four protein complexes: complex I, II, III and IV…
Q: Rationalize the use of all the reagents used in Agarose gel electrophoresis.
A: Agarose gel electrophoresis is a technique used to separate nucleic acids based on the size. The…
Q: 1. Hydrolysis of 1 M glucose 6-phosphate catalyzed by glucose 6-phosphatase is 99% complete at…
A: Standards free energy change calculated at biochemical standards is called biochemical standard free…
Q: True and false - A k+ channel will be just as permeable to Na+ as to K+ because Na+ is a smaller ion…
A: Ion channels are proteins that form pores in the plasma membrane and allow ions to pass through in…
Q: ATP + H₂0 ➜ ADP + Pi 3Na+ (inside) + 2K+ (outside) AG = -30.5kJ/mol + ATP4 + H₂O → 3Na* (outside) +…
A: Gibbs's free energy, known as free energy or G, is a thermodynamic quantity that represents the…
Q: The rate constants of an enzyme-catalyzed reaction, obeying the Michaelis-Menten kinetics, have been…
A: The enzyme interacts with the substrate by attaching to its active site to produce the…
Q: Can someone please show your work for tracking the radiolabel: draw structures indicating position…
A: The given structure is a polysaccharide - starch (amylose) with alpha 1,4 glycosidic bond. It…
Q: 1.a)Which one of the following vitamins is fat-soluble? Vitamin B12 Vitamin D Vitamin B1 Vitamin B3…
A: Introduction Vitamins are the organic substances which is required for our growth and development.…
Q: Some types of tumors express cell-surface receptors that are specific for unique peptide sequences.…
A: Of these 9 amino acids, 7 amino acids(H,W,S,Y,L,P,G) will be carrying a positive charge at pH 4. At…
Q: In experiment,how would you approach determining the potency of an agonist to the D2 receptor?
A: Dopamine is a neurotransmitter, a chemical messenger that plays a role in a variety of physiological…
Q: 3 4 Ag₂O NH₂OH, H₂O KMnO H₂O*
A: 3. This is an example of Tollens's reaction. Where Ag2O and NH4OH reacts to form ammonical silver…
Q: Cholera is an acute, diarrheal disease caused by infection of the intestine with the gram-negative,…
A: Proteins are high molecular weight biomolecules made up of amino acid residues linked via peptide…
Q: What does it mean for an amino acid to be polar? Please explain what qualities about an amino acid…
A: Proteins are folded polypeptides. A polypeptide is a polymer of amino acid residues linked via a…
Q: Prepare a schematic diagram and present it. The Figure should illustrate the interactions made…
A: Binding of drug to receptor or protein can be specific and non-specific. For the genuity of the…
Q: what is the dna concentration suspended in PO4 buffer at ph 7.0 that has an absorbance at 260 nm…
A: DNA concentration of a sample can be determined using spectrophotometry and measuring the absorbance…
Q: Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA?…
A: The given sequence belongs to the XPA gene of humans. This responsible for nucleotide excision…
Q: Consider a peptide with the sequence Ala-Glu-Arg-Leu. Assume the ionizable groups have the pKa…
A: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal amino acid on…
Q: Draw estimated macroscopic currants for Na and k by multiplying the single channel
A: The sodium-potassium pump is also known as the Na+/K+ ATPase pump. It is a type of active transport…
Q: What is the x-intercept for the above reaction on a Lineweaver-Burk plot? A. -0.5 per mM B. -1.0 per…
A: The Michaelis Menten equation: vo = vmax × [S]Km + [S] where vo is the initial rate of the…
Q: Consider the following α helix from myoglobin at pH 7.…
A: Proteins are folded polypeptides. Polypeptides are amino acid polymers linked to each other via a…
Q: This graph represents a standard curve from a BCA assay for protein concentration. If your BCA…
A: Standard curve can be constructed by using the known concentrations of a sample and their…
Q: Certain proteins undergo Post Translational Modifications (PTMs) with lipid derivatives such as…
A: Post-translational modification Post-translational modification is a process by which proteins are…
Q: Why was it necessary to use phosphoaminophosphonic acid-adenylate ester (ANP) in the ATP synthase…
A: As per the chemiosmotic Model, ATP synthase is the enzyme that phosphorylates ADP with Pi as…
Q: Mutations within this gene CAGATTGTGAAGAGGTCTCTTGA are causative of which human diseases? A.…
A: The nucleotide sequence provided corresponds to the XPA gene of humans. This is deduced by doing a…
Q: Experiment A. You replace spiperone with a radiolabelled drug that has a higher affinity for the D₂…
A: The log dose-occupancy curve is a graph that shows the relationship between the concentration of a…
Q: B. Below is a short segment of a DNA molecule. Translate the DNA codon into mRNA. Use your data…
A: The central dogma of molecular biology explains how the nucleotide sequence in DNA acts as a…
Q: ame: ear and Section: Laboratory Manual in Clinical Chemistry II 2023 Group no: Laboratory Report…
A: 1. The acceptable samples for measurement of Sodium and Potassium are typically blood samples, most…
Q: 10. Assume you have the following stock solutions: 10% sodium dodecyl sulphate (SDS) V'S M NaOH…
A: Dilutions of any solutions can be calculated using the formula: C1V1 = C2V2 Where, C1= concentration…
Q: ~0.766+ 47425 y-0.568x46576 . . . . . X The inhibitor binds at the active site. The inhibitor binds…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: A patient was admitted to the hospital with suspicion of malaria. After the examination was complete…
A: Glucose-6-phosphate dehydrogenase (G6PD) is an enzyme involved in pentose phosphate pathway. Malaria…
Q: 21. The structure of D-arabinose is shown below. How many stereoisomers are possible for this…
A: In carbohydrates, the carbon that is attached to four different groups is called a chiral centre.…
Q: The tests we performed: Molisch’s test Benedict’s test Fehlings test Barfoed’s test Seliwanoff’s…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: Which of the statement/s is TRUE of electrolytes? I. They are positively and negatively charged…
A: Electrolytes are substances present in the blood and carry an electric charge. Osmosis is the…
Q: For the study of alanine production by a recombinant strain of E. coli, cultivation was carried out…
A: A recombinant strain is a type of genetically modified organism (GMO) that has been artificially…
Q: Explain the reason why sugars that are polysaccharides are almost always insoluble in ethanol. B.…
A: Sugars are sweet tasting carbohydrates . Polysaccharides are carbohydrates made up of numerous…
Q: Explain why the fluorescence signal decreases as the concentration of TNT in the sample increases
A: The procedure of immunoassay describes that: TNT-binding antibodies (atb) are chemically attached…
Q: A) Polymer Lipid DNA B) Monomer (or component units in the case of lipids). Draw the specific…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- A portion of the sequence from the DNA coding strand of the chick ovalbumin gene is shown. Determine the partial amino acid sequence of the encoded protein. CTCAGAGTTCACCATGGGCTCCATCGGTGCAGCAAGCATGGAA-(1104 bp)-TTCTTTGGCAGATGTGTTTCCCCTTAAAAAGAA Enter the 3-letter abbreviation for each amino acid in sequence, separated with dashes, and no spaces (example: xxx-xxx-XXX-XXX...) The amino acid sequence is .1104bp..…........Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs (what letters changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions (with spaces), and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - CCTCGTTATGTG - 5' Mutated DNA Sequence: 3' - CCTCGTTATTTG - 5'Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.
- Based on sequences A,B,C. Provide an anticodon sequence that would build this protein. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGGThis is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'
- Given Sequence: 3’-TACGGTCCGGATTCGGTAGCTAGCATC-5’ Provide: Complementary Strand: Transcript Amino Acid Sequence 2.Given Sequence: 5’-GGGCATATGCCGTTTACCGGTTTGACTAAATAACCA-3’ Provide: Complementary Strand: Transcript Amino Acid Sequence 3.Given Sequence: 3’-AAC CAA TAC GTG AGG ATA CCA AGT AAC ACT CCC-5’ Provide: Complementary Strand: Direct Transcript: Transcript for Translation: Amino Acid Sequence:2) Create an MRNA strand based on the given DNA template strand: TACTTCCTATTITCTTGTCA CCGCACT 3) Using the mRNA codon chart, determine the amino acid sequence for the MRNA sequence determined in question 3. 4) Consider the following double-stranded DNA molecule: Complementary Strand: ATGTGTAGTGCGAGTTGA Template Strand: TACACATCACGCTCAACT a) What would be the amino acid sequence coded for by the template strand of the DNA molecule above?BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple
- What is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'Given the following DNA, (A) what is the transcript (MRNA) sequence? (B) What might be the amino acid sequence of the translated protein? 5'– ATGGCGAGGCGGCAGCTGTTATGGTGA – 3'Below is a sequence of DNA.5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF? How many codons are in the longest ORF? What is the frame of the shortest ORF? How many AA are in the shortest ORF? Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortestORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longestORF (from N to C-terminal end)?