First letterUCAUUUUUJUCUUAUUGCUUCUCCUACUGAUUAUCAUAAUGGUUGUCGUAGUG]Phenylalanine UCU(Phe)UCCUCAUCGLeucine(Leu)Leucine(Leu)Isoleucine(Ile)Methionine(Met)Valine(Val)CCUCCCCCACCGb) lysinec) methionined) tryptophanACUACCACAACGGCUGCCGCAGCGCSecond letterSerine(Ser)Proline(Pro)Threonine(Thr)Alanine(Ala)UAUUACUAAUAGCAUCACCAACAGAAUAACAAAAAGGAUGACGAAGAG]Tyrosine(Tyr)StopStopHistidine(His)Glutamine(Gln)Asparagine(Asn)Lysine(Lys)Aspartic acid(Asp)Glutamic acid(Glu)UGUUGCUGAStopUGG Tryptophan(Trp)CGUCGCCGACGGAGUAGCAGAAGGGGUGGCGGAGGG]1. List the mRNA base codons for the amino acids listed below.2. a)aspartate:Cysteine(Cys)Serine(Ser)UCArginine(Arg) AGArginine(Arg)UCGlycine(Gly)AGUCAGUMCAGА

mRNA base codons are sequences of three nucleotide bases (adenine, guanine, cytosine, or uracil) in…

Answered: 1. List the mRNA base codons for the…

Science

Biology

1. List the mRNA base codons for the amino acids listed below. 2. a) aspartate: b) lysine c) methionine d) tryptophan

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 15QP

See similar textbooks

Related questions

Q: Please answer both, thank you

A: Here the first one is about the adenylyl cyclase in signal transduction pathways. Adenylyl cyclase…

Q: Describe the role of surfactant in the lungs, including explanations of Laplace's law and how this…

A: The lungs are composed of millions of tiny air sacs called alveoli, which are responsible for gas…

Q: Jack is applyng to Gate's foundation for a grant to make a high affinity, humanized monoclonal…

A: An antibody known as a monoclonal antibody (mAb) is produced by cells in the immune system that…

Q: What type of media is used to encourage the growth of only the suspected pathogen from nonsterile…

A: The growth media or culture media is used to grow microorganisms in the laboratory conditions.…

Q: 1. What are the functions of MHC I and MHC II? Which cells have MHC I? Which cells have MHC 2? Do…

A: Major Histocompatibility Complex (MHC) it's a tightly linked cluster of genes, which plays an…

Q: ADCC is an important mechanism for eliminating parasites and pathogen-infected cells. Go back and…

A: The immune response is the bodys complex system of defense mechanisms that is activated when the…

Q: Question 8. What current method for cancer treatment attempts to involve the body's immune system to…

A: Immunotherapy is a form of cancer treatment that aims to boost the bodys immune system to fight…

Q: Relationship between structure and biological activity 1. Explain what you understand by the term…

A: Enzymes help with many things in living creatures, like breaking down food, making energy, passing…

Q: $$ R ANSWERING QUESTION 4 Chromosome Pair 1 X XX agram above represents the condensed chromosomes at…

A: Meiosis involves two divisions. First one is reduction division and the second one is equational…

Q: Question 6 Which is true about oogenesis? a. The process of oogenesis occurs in the uterus Ob. The…

A: Oogenesis is the process by which oogonia or female germ cells go through meiosis to develop into…

Q: Deafness in cocker spaniels is inherited. The allele for deafness is recessive to the allele for…

A: The allele for deafness is recessive and normal hearing is dominant. So, a cocker spaniel with…

Q: The terms specificity, receptors, and down-regulation can be applied to many physiological…

A: The endocrine system is a collection of glands and organs in the body that produce hormones and…

Q: 2. When are sensitivity and specificity values 'good enough' to launch/recommend a diagnostic test ?…

A: Diagnostic tests are essential for detecting and diagnosing a number of diseases. A diagnostic…

Q: Are viruses living? Why or why not? What does obligate intracellular parasite mean? What does…

A: Viruses- Viruses are acellular, which means they do not have cellular structure.

Q: Discuss the virulence of bacterial pathogens on the basis of proteinase activity.

A: Bacterial proteinases are enzymes that break down proteins and are produced by various bacterial…

Q: What, generally, does the enzyme aromatase do? a)Produces cortisol from cholesterol b)Converts…

A: Enzymes are also known as biocatalyst. An enzymes increases the rate of a chemical reaction by…

Q: Answer choices are either "high, low" or "yes, no"; For the question: "what is the level of…

A: The lac operon is a group of genes in bacteria that work together to regulate the breakdown and…

Q: An adolescent characterizes herself as outgoing around friends but shy around adults and teachers.…

A: An adolescent is a person who is in the stage of development between childhood and adulthood. This…

Q: COVID-19 a. Should there be clinical trails performed by agents (institutions) outside the very…

A: Answer 1 : yes, There should be clinical trails performed by agents (institutions) outside the very…

Q: Contrast diagnostic and predictive genetic testing. What are the potential benefits and drawbacks of…

A: The basic unit of hereditary which pass from parents to child is known as gene. It made up of…

Q: ATM is a kinase that phosphorylates histone H2AX in response to double-stranded DNA breaks. Which of…

A: ATM (Ataxia Telangiectasia Mutated) is a protein kinase that plays a critical role in the cellular…

Q: The following variances were calculated for two traits in poodles. Vp VG 20.1 8 Trait Tail length…

A: Environmental and genetic factors are responsible for the variations seen in the phenotype of…

Q: With regard to cytoskeletal structure and function, describe the molecules involved in the transport…

A: The endoplasmic reticulum is an organelle that plays a crucial role in protein and lipid synthesis,…

Q: What is the function of the Fc portion of antibodies? List an example. How can phagocytic cells…

A: The antibodies are the glycoproteins present on the B-cells of the immune cells and secreted by the…

Q: Which two molecules are necessary for every CRISPR gene editing experiment? What additional molecule…

A: Different methods are used to introduce these molecules into the cells being targeted for gene…

Q: What is the age in years of a bone in which the 14C/12C ratio is measured to be 1.25×10−13?

A: The measure of a child's maturation of bones can be determined by bone age. The bones of the…

Q: Corals are members of the Class Anthozoa (in the Phylum Cnidaria). Which statement is true of all…

A: Anthozoans are a class of marine invertebrates in the phylum Cnidaria, which includes corals, sea…

Q: 8. Create a food web using the following food chains Berries to Deer to Black bear Algae to Salmon…

A: Energy flow refers to the passage of energy through a system of organisms or through an ecosystem.…

Q: Which one of the following statements is NOT true of histones? O They are involved in the packaging…

A: Histones are fundamental proteins that play a key role in the packing of eukaryotic DNA. Histones…

Q: Describe the main characteristics and differences between innate and adaptive immunity. How does the…

A: The immune system is a complex network of cells, tissues, and organs that protects the body from…

Q: 11. Based on the figure at right... A. The O₂ carrying capacity of carp blood is higher than that of…

A: The oxygen equilibrium curve is a graph that shows the relationship between the partial pressure of…

Q: Using supporting calculations, determine the energy and cost (carbon) savings associated with the…

A: We require detailed data on the treatment plant's influent ammonia content, flow rate, and operating…

Q: Table 2 Restriction endonuclease digest of genomic DNA Reaction components gDNA Hpall OR Mspl .…

A: Restriction enzymes These enzymes are proteins that have the ability to cleave the sequence of DNA…

Q: Briefly describe specifically how the presence of our enzyme of interest is being detected/observed…

A: The Urease test is a biochemical test used to detect the presence of the enzyme urease in…

Q: 3. Complete the table to indicate whether each lineage of plants life cycle is gametophyte dominant…

A: Plants go through alternating generations of haploid (n) and diploid (2n) individuals during their…

Q: What important function does the cytoskeletal system have in the cell? All of the other answers…

A: The cytoskeleton is a network of protein fibers that provides structural support and organization to…

Q: Active vs Passive vaccination, which is false: A. Passive vaccination: involves infusion of another…

A: Passive vaccination or passive immunization is referred to the administration of antibodies to an…

Q: Which of the following is characteristic of a person with A+ blood type? 1) produces A antigen, Rh…

A: ABO blood grouping is a system used to classify human blood based on the presence or absence of…

Q: Give examples of two behavioral disorders. For each disorder, list the symptoms, possible genetic…

A: Behaviors refer to the range of actions and mannerisms made by individuals, organisms, systems or…

Q: strengths and weaknesses of darwin’s theory of evolution

A: Charles Darwins theory of evolution by natural selection first published in his book "On the Origin…

Q: Describe the structure of triacylglycerol (TAG) and explain the hydrolysis of TAG.

A: Lipids are a group of naturally occurring molecules that include fats, waxes, sterols, fat soluble…

Q: Eicosanoid hormones such as prostaglandins and leukotrienes are responsible for localized immune…

A: Cells can communicate with each other and respond to external changes through chemical signals.…

Q: urease test can be used during the diagnosis of Helicobacter pylori infections. List some signs and…

A: Humans stomach lining can become infected with the bacteria Helicobacter pylori. It frequently…

Q: True or false: Checkpoint blockade therapies such as monoclonal antibodies which bind to PD1/PD-L1…

A: Checkpoint blockade therapy is a type of immunotherapy that helps the immune system to recognize and…

Q: Epithelial cell progenitor cell western blot Rab11a GAPDH (reference protein)

A: Mesenchymal-to-epithelial transition is a reversible biological process that involves the transition…

Q: Give typing answer with explanation and conclusion Which does not denature protein Group of answer…

A: We are given few options about the denaturing of protein and we need to find out which option is…

Q: A biologist develops a new drug that seems to dramatically slow the onset of symptoms resulting from…

A: HIV stands for Human Immunodeficiency Virus. It is a type of virus that attacks and weakens the…

Q: 1 You have 200 tissue cassettes to process overnight, how would you setup or programme your VIP ATP?…

A: Researchers utilize analytical methods in science to consider living things, little particles, and…

Q: Q5.8. Which of the following statements about the response of peat bogs to climate change is true?…

A: A peat bog or bogland is a wetland that accumulates peat. Peat is obtained by the decomposition of…

Q: What are the advantages and disadvantages of “Radiolabeling”? Please give an elaborate examples that…

A: Radiolabeling is a technique used to attach a radioactive isotope to a molecule of interest, such as…

Concept explainers

Proteins

We generally tend to think of proteins only from a dietary lens, as a component of what we eat. However, they are among the most important and abundant organic macromolecules in the human body, with diverse structures and functions. Every cell contains thousands and thousands of proteins, each with specific functions. Some help in the formation of cellular membrane or walls, some help the cell to move, others act as messages or signals and flow seamlessly from one cell to another, carrying information.

Protein Expression

The method by which living organisms synthesize proteins and further modify and regulate them is called protein expression. Protein expression plays a significant role in several types of research and is highly utilized in molecular biology, biochemistry, and protein research laboratories.

Question

First letter
U
C
A
UUU
UU
JUC
UUA
UUG
CUU
CUC
CUA
CUG
AUU
AUC
AUA
AUG
GUU
GUC
GUA
GUG
]
Phenylalanine UCU
(Phe)
UCC
UCA
UCG
Leucine
(Leu)
Leucine
(Leu)
Isoleucine
(Ile)
Methionine
(Met)
Valine
(Val)
CCU
CCC
CCA
CCG
b) lysine
c) methionine
d) tryptophan
ACU
ACC
ACA
ACG
GCU
GCC
GCA
GCG
C
Second letter
Serine
(Ser)
Proline
(Pro)
Threonine
(Thr)
Alanine
(Ala)
UAU
UAC
UAA
UAG
CAU
CAC
CAA
CAG
AAU
AAC
AAA
AAG
GAU
GAC
GAA
GAG
]
Tyrosine
(Tyr)
Stop
Stop
Histidine
(His)
Glutamine
(Gln)
Asparagine
(Asn)
Lysine
(Lys)
Aspartic acid
(Asp)
Glutamic acid
(Glu)
UGU
UGC
UGA
Stop
UGG Tryptophan
(Trp)
CGU
CGC
CGA
CGG
AGU
AGC
AGA
AGG
GGU
GGC
GGA
GGG
]
1. List the mRNA base codons for the amino acids listed below.
2. a)
aspartate:
Cysteine
(Cys)
Serine
(Ser)
U
C
Arginine
(Arg) A
G
Arginine
(Arg)
U
C
Glycine
(Gly)
A
G
U
C
A
G
U
MCAG
А

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1: MRNA base codons

VIEW

Step 2: Solution

VIEW

Solution

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Second letter A UUU UCU) UC UCA UCG UAU UUC Phe UUA Tyr UGU UGCJ Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUG Leu CAUHIS CUU CUC CUA CUG CCU* C ССА CCG CGU His САС Leu CGC Arg CGA Pro CAA Gin CGGJ Gln Which amino acid is carried by the TRNA with the anticodon 5'-UCA-3? ACU ACC ACA AAU AAC. AGU AGC AGA AUU Ser Asn AUC Ile A AUA Thr AAA Lys AAG Lys AGG Arg AUG Met ACG GAU GGU] GUU GUC GUA GUGJ GCU GCC GCA GCG GAC Asp Ala GAA GGC Gly GGA Val GAG Glu GGGJ Isoleucine. None-this is a stop codon. Aspartic acid. Histidine. IV. Leucine O V. Third letter UCAG UCAG UCAG First letter
Draw the structure of this peptide: N-Met-His-Tyr-Leu-Asp-Ser-Arg-Leu-C
Amino Acid: Asn-Met-Ser-Ile-Phe-Arg-Cys-Tyr-Lys What is the one letter code of this amino acid and what is its classification? What is the side chain description (e.g. amide, aromatic etc.)
After the polypeptide shown below was treated with maleic anhydride, it was hydrolyzed by trypsin. (After a polypeptide is treated with maleic anhydride, trypsin will cleave the polypeptide only on the C-side of arginine.) Gly-Ala-Asp-Ala-Leu-Pro-Gly-Ile-Leu-Val-Arg-Asp-Val-Gly-Lys-Val-Glu-Val-Phe-Glu-Ala-Gly-Arg-Ala-Glu-Phe-Lys-Glu-Pro-Arg-Leu-Val-Met-Lys-Val-Glu-Gly-Arg-Pro-Val-Gly-Ala-Gly-Leu-Trp In what order will the fragments be eluted from an anion-exchange column using a buffer of pH = 5?
Draw a peptide for cys-asn- pro-gly (Using the same format in picture)
Subjecting this peptide to trypsin would result in L-M-F-V-W-E-Q-A-P-S-P O A. Lys and Met-Phe-Val-Trp-Glu-Gln-Arg and Pro-Ser-Pro OB, Leu-Met-Phe-Val-Trp-Glu-Gin-Ala-Pro-Ser-Pro Leu and Met-Phe-Val-Trp-Glu-Gln-Arg-Pro-Ser-Pro OC. Op. Lys and Met-Phe-Val-Trp-Glu-Gln-Ala-Pro-Ser-Pro Leu and Met-Phe-Val-Trp-Glu-Gin-Arg-Pro-Ser-Pro OE.
Draw the peptide at a pH @1 of Cys-His-Glu-Met-Ile-Ser-Thr-Arg-Tyr
Cut the following protein with the Serine Proteolytic enzyme Trypsin. How many peptide fragments are present after the protein is treated with Trypsin? Val-lle-Arg-Lys-Leu-Arg-Gly-Ala-Lys-lle 6. 10
The melanocyte-stimulating hormone a-melanotropin has the following sequence: Ser-Tyr-Ser-Met-Glu-His-Phe-Arg-Trp-Gly-Lys-Pro-Val In the one-letter code of amino acids, this sequence would be: SYSMEHFRWGKPV STSMGHFAWGKPV O SYSMDHFAWGKPV O SYSMEHFAWGLPV
After a polypeptide chain has been synthesized, certain amino acids in the peptide may become modified. For each modified amino acid, identify the standard amino acid from which it is derived. Enter the unabbreviated name of the standard amino acid. OH I *NH,CH,–C–CH,CH,—CH–COO H C *NH₂ standard amino acid: Identify the modification that yields the first amino acid depicted. addition of a hydroxyl group addition of an amino group modification of the existing amino group modification of the existing hydroxyl group elongation of the side chain by the addition of a -CH₂- group
Drew the peptide sequence and write its full name Cys-Gln-Lys-His-Ala-Ser-Gln
Using the following sequence and the amino acid chart, please give the amino acid sequence: 5'-UCAGAUGGGAAGCUUGAUCUUGUGA-3'. Abreviations for the amino acids are accepted. Second Position U A G UGU Cys UUU Phe UUC UCU UCC UCA UCG UAU ]Tyr UAC UGC UGA Stop UGG Trp Ser UUA Levu UUG UAA Stop UAG Stop CUU CỤC CUA CUG CU CC ССА CCG CAU His CAC CGU CGC CGA CGG Leu Pro Arg CAA CAG Gln AUU AUC le AUA AUG Met ACU AAU AAC AAA AAG AGU Ser AGC AGA Arg JAsn ACC The АCА Jlys ACG AGG GCU GGU GGC Gly GUU GAU JAsp GAC GUC Val GUA GCC Ala GCA GAA GGA GGG- GCG- GAG JGlu GUG Third Position (3' end) First Position (5' end)