What is the dna strand sequence for phosphate sugar backbone?
Q: *Which of the following statements about allosteric enzymes is NOT true? Question 10 options: - They…
A: Allosteric enzymes have binding sites other than active sites for the regulator molecules that…
Q: explain with proper details please. Compare the net production of ATP from four molecules of…
A: Glucose is a carbohydrate and it is degraded into carbon dioxide through glycolysis, pyruvate…
Q: What is the general definition of an uncoupler protein? In the context of oxidative phosphorylation,…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: One of the following is most accurate about relative redox potential of different electron carriers.…
A: Electron carriers are molecule that is capable of accepting one or more electrons (acceptor) from…
Q: A. Lysine: Polar basic: Calcium absorption B. Proline: Nonpolar imino acid: Protein synthesis C.…
A: A. Lysine is basic, has R group that is significantly positively charged at pH 7. It has second…
Q: A) Discuss the significance of anomeric carbon in carbohydrates. B) Explain the differences between…
A: Anomeric carbons represent the carbon around which anomers rotate. This anomeric carbon is a…
Q: Break down this fatty acid. Show all the products made and the enzymes needed for any non-normal ß…
A: Fatty acids are building blocks of fats and composed of carboxylic acid with long aliphatic chain.…
Q: The fact that some eukaryotic rRNAs are self-splicing indicates that (A RNA can contain modified…
A: When transcription of DNA to RNA happens the introns are removed either by the RNA itself or by a…
Q: What is the role of the prep phase in glycolysis? To convert G3P molecules into pyruvate and produce…
A: In glycolysis, the glucose molecules are broken down into two molecules of pyruvate along with the…
Q: In Table 13-1, what is the most common function of proteins that contribute to pattern formation?…
A: Drosophila melanogaster, a fruit fly, is utilised as a model organism in research spanning from…
Q: 1) Below you are given the structures of the disaccharides lactose and trehalose. но OH OH OH но но…
A: Lets first assume that all the carbohydrates given here are D isomers , cause that the general case…
Q: A recent genome sequencing project for the bacterium Burkholderia mallei has identified a new…
A: The new protein identified here has a partial sequence given as TVEVNAPGDVQKALSELQQINDGRLDIRI…
Q: Only one of the statements below is correct; which one? Two solutions are hypotonic when they have…
A: Tonicity is a parameter of the effective osmotic pressure gradient, which is the difference in water…
Q: N-glycosyltransferase attaches which sugar to the base oligosaccharide to synthesize the B antigen?…
A: Antigens and antibody combination help in determination of blood type. Antigen B binds to antibodies…
Q: is an amino acid that can be directly converted into a citric acid cycle intermediate by being…
A: Citric acid cycle is the final common oxidative pathway for carbs, proteins and lipid. Amino acids…
Q: Show the amount of ATP were produced in beta-oxidation of lauric acid, and differentiate both the…
A: Lauric acid has a 12-carbon backbone and is a saturated medium-chain fatty acid. Under anaerobic and…
Q: INCREASE in BP DECREASE in BP Increased preload Activation of the adrenergic system Venoconstriction…
A: The blood pressure alteration is influenced by many factors. The changes in blood pressure are…
Q: All of the following are standard tests used in diagnosing diabetes EXCEPT O Glycated hemoglobin…
A: Diabetics is disease in which blood glucose level in increase more than 126mg/dL.In diabetics…
Q: Under what conditions will lactic acid accumulate in skeletal muscle? Select one: A. When NADH is…
A: A reduction in muscle force generated over time or as a result of pathological conditions is…
Q: It is known that 80% of Penicillin is protein bound. Explain how most of it is being cleared from…
A: Penicillin is an antibiotic and a beta lactam drug. Penicillin upon administration into humans , go…
Q: 2. Which of the following macro-molecule can be most structurally diverse among this living world?…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Q1: Explain the effect of pH value on the amino acid ionization. Q2: Describe two reactions for…
A: Amino acids and their ionization: Amino acids are the basic building blocks of proteins, they are…
Q: 20. Beta-oxidation of fatty acids takes place at A. peroxisome B. mitochondria C. mitochondria and…
A: Beta oxidation of fatty acid - Process via which the fatty acids get broken down for energy…
Q: Unsaturated fatty acids are commonly esterified at the hydroxyl substituent of glycerol at what…
A: Glycerol : It has 3 hydroxyl groups that get esterified with 1,2 or 3 fatty acids giving…
Q: Prompts Submitted Answers Eukaryotic rRNA genes are transcribed and Choose a match processed in the…
A: 1. Eukaryotic rRNA genes are transcribed and processed in the :- NUCLEOLUS.
Q: ins that mady De (A) constitutive proteins B B isoforms C spliceosomes
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Select the lipid that does not have any fatty acyl groups in its structure: glycerophospholipid,…
A: Fatty acids are important micromolecules which combine together to form lipids in plants, animals…
Q: Give 5 examples of molybdenum complexes. State their physical and chemical properties and their…
A: The atomic number of molybdenum is 42 and it is represented by the symbol 'Mo'. On the earth,…
Q: H3C H3C. HyC O Triglyceride O Fatty acid Glycerol
A: Fatty acids are important micromolecules which combine together to form lipids in plants, animals…
Q: 18:3CA9,12,15
A: Alpha Linolenic acid is essential fatty acid, highly concentrated in plant oils. Essential fatty…
Q: Urease enzyme hydrolysed urea at [S]= 0.03 mmol/L with a Km value of around 0.06 mmol/L. The initial…
A: Vmax is the reaction's maximum speed at which all of the enzymes become saturated with the…
Q: Match the following descriptions to the given choices…
A: Vitamin - The organic molecule and an essential micronutrient which is required by any organism in…
Q: What is the Keq for the conversion of Glucose 6-Phosphate to Glucose 1-Phosphate if the phosphate…
A: Given- 1) Potential for Glucose 1-phsophate.- 20.9KJ/mol 2) potential for Glucose 6-Phosphate-…
Q: temperature of 15 degree Celsius or lower needed for growth / optimal activity. * (Please choose one…
A: A) Thermophiles: Thermo meaning temperature and philus meaning lover , this type of organism which…
Q: Glucolate is oxidized into Glvoxylate by cytechrome C using the glycolate oxidase enzyme. The two…
A: Glycolate oxidase is a key enzyme involved in the conversion of glycolate to glyoxylate during…
Q: Explain the biochemical consequences of Glucose-6-Phosphatase deficiency that results in gout due to…
A: The enzyme glucose-6-phosphatase regulates the release of glucose from glycogen stored in the liver.…
Q: Which of the following is a property of an enzyme? * (Please choose one correct answer only)…
A: Enzymes are the biological catalysts that mediate biochemical reactions by decreasing their…
Q: ACTIVITY 7.2.2 Show and explain how exactly the condensation reaction to form a nucleotide happens.…
A: Nucleotides are the phosphoric acid esters of nucleosides with the phosphate group. Nucleotides are…
Q: Which of the following contain a correct first statement and an incorrect second statement?…
A: G proteins consist of the alpha, beta and gamma receptors for activating the cell signaling…
Q: Identify the ff nucleic acid bases and then classify whether it is a purine or pyrimidine.
A: Nucleic acids are also known as polynucleotides. Monomeric units of nucleic acids are called…
Q: Describe the ion dynamics of the muscle-contraction process.
A: Tension-generating regions within muscle cells are activated during muscular contraction. Muscular…
Q: TBP is a eukaryotic DNA binding protein that specifically recognizes the Pribnow box. True False
A: Introduction: The TATA box binding protein provides instructions for making a protein called TATA…
Q: When the blood glucose is low, insulin is released from the pancreas to maintain glucose…
A: Introduction: Homeostasis is the maintenance of a stable internal environment within an organism,…
Q: fat excess from the liver) in initial stages of liver cirrhosis, toxic liver lesions, and chronic…
A: Since, you have posted a question with multiple sub-parts, we will solve first three sub-parts for…
Q: he figure shows that the average distance between base pairs measured parallel to the axis of a DNA…
A: The nucleic acid polymer has nucleotide as its monomeric unit. synthesis of nucleotides is an…
Q: Question 24 CH,-0-C-(CH,)14–CH, CH-0-C-(CH,)16-CH, CH3 сH, —о—р—о—сH, — сн, — N—сH, CH, What is the…
A: Depending on the strut of lipid ,they are classified as simple and complex lipid. Simple lipids are…
Q: What is the most stable nitrogenous base pairing?
A: Base can be purines (adenine and guanine) two ring structure and pyrimidines (cytosine and thymine).…
Q: 1. Draw the complementary DNA strand for the given: 5'-A-T-C-C-G-A-A-T-T-G-3' Answer: 2. Draw the…
A: In a complementary base pairing, purine pairs with a pyrimidine. A always pairs with T, similarly C…
Q: Which of the following statements are TRUE? Multiple answers:Multiple answers are accepted for…
A: In given Questions many statement given about glycolysis cycle.Glycolysis is the metabolic pathway…
Q: When [I] is 10-7 M, 99% of P's activity is inhibited. What is the Kd of this Protein- Inhibitor…
A: Protein can function as enzymes, signal molecule, ligand, receptor, etc. Its function can be…
What is the dna strand sequence for phosphate sugar backbone?
What are sticky ends in restriction enzymes
can you examples to help me understand.
Does where you cleave affect the length of the sticky ends overhang?
5-3directionalytgg atc gat atc gcc aat.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- Draw the gel electrophoresis results for the following 16 kb plasmid when the plasmid is cut withrestriction enzyme A, with restriction enzyme B and with both A and B restriction enzymes. The Aenzyme cuts at positions 0 and 9.2 kb and the sites are shown as white. (0 is at the top of the circle.) TheB enzyme cuts at positions 3.8, 7 and 13.2 kb and the sites are shown as gray. Show the electricalpolarity of the gel, the bands, and their sizes in your drawing. Make sizes consistent between gel lanes.Explain why the concept of charge density is important for gel electrophoresis.Kha Vu Danels Include: 8DX : Safehy Jor bromie tnto lab repart! Name Section date sheet MAPPING PRACTICE #1 Below is a restriction map for the plasmid PGEN 101 (total length = 20 Kb). Using this map as a guide, give the number of restriction fraqments along with their associated lengths that would result from digesting PGEN 101 with the restriction enzymes EcoRI, BamHI and a combination of ECORI and BamHI. BamHI 3.2 Kb 1.7 Kb EcoRI BamHI PGEN 101 8.7 Kb 5.5 Kb .9 Kb EcoRI ECORI DIGESTION PERFORMED SIZES OF FRAGMENTS OBTAINED 10.4 kb , 0.9kb, 8.7 Kb EcoRI 3.2 Kb, 16. 8kb BamHI EcoRI + BamHIYou are studying a new plasmid, and you digest the plasmid with three restriction enzymes: Eco RI (E), HindlII (H), and Xbal (X). You digest the plasmid DNA with each of the following combinations of enzymes and observe the results on an agarose gel. You are provided a partial plasmid map as shown below to the right. E H E+H E+X H+X Kb +4.3 +2.8 +2.5 - +2.0 -- -1.8 -1.5 12 +1.0 +0.8 +0.5 - a. What is the size of this plasmid in base pairs? b. What is the distance in base pairs between E1 and H? c. What is the distance in base pairs between E1 and X? d. What is the distance in base pairs between E2 and H? e. What is the distance in base pairs between E2 and X?
- Restriction Enzymes Handout plasmid Restriction Enzymes Bam HI Eco RI Hpa I Hind III Nde I Please solve this question in less than 15 minutes for genetics engineering Sal I Plasmid Handout DNA Sequence (both strands are represented) GIGATCC CCTAG G U G|AATTC CTTAA G GTT | AAC CAAjTTG A|AGCTT TTCGA | A CATATG GTATAC G|TCGAC CAGCT | G agtgacata tga ttcgag c cggta a c tca ctgtat a ст aagctcgagccattg cggggat cctctag agtcgacctgcagg c gcccctaggagatctcagctgga cgtc cg tagca ag c tggcgt at atggta cata at cgttcga accgcattagtaccat gta t gggatceptet ct ccagtaggtaggc cgtcg ccct agga aga g g t catccat cc ggcag c Antibioty Resistance gene gc taggetta a actgggatccat gcc origin o tplgm cg at cc a at ttgaccctaggta cgplasmid replication What is the role of the plasmid ? Explain the experimental details of the transformation. How can the success of transformation be observed ?The following are the restriction enzyme sequences. The slash indicates the cut in the DNA sequence. EcoRI: 5' G/AATTC 3' Hind IlI: 5' AG/GATCC 3' Bam Hl: 5' G/GATCC 3' For DNA sequences 1,2 and 3 (below) Write the 3' to 5' DNA bottom strand • Write the mRNA sequence of top strand Write the mRNA sequence of bottom strand Write the Protein sequence of the Bottom strand • Which enzyme should be used to differentiate (detect the mutation) in sequence 2 1) cac agt aca tca gac atg gat cca agc cca tgt ata ccc cg aac 2) cac agt aca tca gac atg gtT cca agc cca tgt ata ccc ccg aac 3) cac agt aca tca gac atg gaC cca agc cca tgt ata ccc ccg aac Edit View Insert Format Tools Table 12pt v ParagraphBelow is a plasmid with restriction sites for Baml and EcoRI, Several restriction digests were done using these two enzymes either alone or in combination. Hint: Begin by determining the number and size of the fragments produced with each enzyme. "kb" stands for kilobases, or thousands of base pairs. Plasmid Gel lanes I | III IV V 6 Kb Bam HI Bam HI. 20 Kb PGEN101 (20 Kb) 2 Kb 11 Kb Bam HI 8 Kb 8 Kb 4 Kb 6 Kb Eco RI 3 Kb 21. Which lane shows a digest with BamHl only? a. I b.I c. II d. IV e. V 22. Which lane shows a digest with EcoRLonly? a. I 23. Which lane shows the fragments produced when the plasmid was incubated with both EcoRI and BamH1? a. I b.I c. II d. IV e. V b. I c. II d. IV e. V Base pairs
- A piece of DNA fragment is sequenced. You clone the the fragment, isolate the cloned DNA fragment, and set up a series of four dideoxy reaction. You then separate the products of the reaction by gel electrophoresis and obtain the following banding patter: ddATP ddTTP O 5'-ATTCGACT-3' O 5'-TCAGCTTA-3' What is the base sequence of the synthesized fragment? O 5'-AGTCGAAT-3' ddCTP O 5'-TAAGCTGA-3' I ddGTPetion enzyme Sall cuts the sequence GTCGAC to leave a five base, 5' overhang. The restriction enzyme Xhol The he sequence CTCGAG to leave a five base, 5' overhang. You mix a Sall-digested insert with a Xhol digested plasmid vector and perform a ligation. Draw your Sall digested insert and your Xhol digested plasmid vecior. Then ligate them in place and draw the insert in the vector. Use two different colors to distinguish the vector and the insert. Does your insert ligate into the vector in a specific orientation? Yes, or no? Explain.You digest 4 uL of plasmid DNA that is 50 ng/uL concetration in a total volume of 20 uL. You run 10 uL of the digest on teh gel. You then do a DNA purification protocol with a Zippy prep on the remaining digested DNA. You elute the DNA in a 25 uL. A 2 uL ssample has the concentration of 2 ng/uL. What is the DNA yield?
- U have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the number of and length of the fragments be if you cut the plasmid with the following restriction enzymes or combination of enzymes? Give a schematic representation of the digestions. PscI & GsuI ______________________________________________________________ ScaI, PdmI & BsaXI ______________________________________________________________ ScaI, SspI & EheI ______________________________________________________________You digest 4 uL of plasmid DNA that is 50 ng/uL concetration in a total volume of 20 uL. You run 10 uL of the digest on teh gel. You then do a DNA purification protocol with a Zippy prep on the remaining digested DNA. You elute the DNA in a 25 uL. A 2 uL ssample has the concentration of 2 ng/uL. What is the DNA yield? YIELD = How much dna came out of the column/how much DNA was loaded onto the columnRemember to subtract amount of DNA run on gel from total digested DNA to get hw much DNA was loaded onto the columnAmount that came out of the column equals the volume of the eluted DNA times the concentration of the purified DNAA student wanted to load .75 ug dna on agarose gel and has 4x loading buffer for sample preparation. The student has 50ul purified plasmid, finding concentration of plasmid to be 250 ng/uL The student used 10uL plasmid DNA in 50uL reaction for the restriction digest Give the volumes of restriction digest and 4x loading buffer that student would mix together and load on agarose gel.