Two sets of sequenced DNA fragments for question #13 (A) In this example, a DNA sequence of 150 bases is cut with two different restriction enzymes, producing the following fragments, each of which has been sequenced. Fragments from the first restriction enzyme: GGTCGGCTATGTAACGAGTTGCC тсттоттсстассттотсAлСССGGGAТGAATOTTTACTO САCCCGGACCGTсссттCAT GTCCCAGAGCстаттасалаллат GCCCACCTT TTATTGAGTTGATGCTCGACGTAGCCAGACTTAA Fragments from the second restriction enzyme: ACCGGGGATGAATGTTTACTGGTCGCAGAG ссТАттасаAGAAатсатсааста сттетсA TGATGCTCGACGT сотссаттсAт AGCCAGACTTAACACGCGGAC тоталсаAOттоссосСсАCсттттATталот тсттеттсстаG Try to piece these fragmentary sequences together and determine the entire sequence of 150 bases, before you turn the page. Figure 4-8a Biology Today, 3le (0 2004 Garland Science)
Two sets of sequenced DNA fragments for question #13 (A) In this example, a DNA sequence of 150 bases is cut with two different restriction enzymes, producing the following fragments, each of which has been sequenced. Fragments from the first restriction enzyme: GGTCGGCTATGTAACGAGTTGCC тсттоттсстассттотсAлСССGGGAТGAATOTTTACTO САCCCGGACCGTсссттCAT GTCCCAGAGCстаттасалаллат GCCCACCTT TTATTGAGTTGATGCTCGACGTAGCCAGACTTAA Fragments from the second restriction enzyme: ACCGGGGATGAATGTTTACTGGTCGCAGAG ссТАттасаAGAAатсатсааста сттетсA TGATGCTCGACGT сотссаттсAт AGCCAGACTTAACACGCGGAC тоталсаAOттоссосСсАCсттттATталот тсттеттсстаG Try to piece these fragmentary sequences together and determine the entire sequence of 150 bases, before you turn the page. Figure 4-8a Biology Today, 3le (0 2004 Garland Science)
Biology: The Dynamic Science (MindTap Course List)
4th Edition
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Chapter19: Genomes And Proteomes
Section: Chapter Questions
Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...
Related questions
Question
100%
Describe the process for shotgun sequencing of a genome. Practice aligning the two sets of sequenced fragments below, to determine the order of the fragments and the complete sequence.
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution!
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:
9781305389892
Author:
Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:
Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:
9781305389892
Author:
Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:
Cengage Learning