Q: ACAACCCCAAGCCTTC
A: Answer : PROBE - DNA probes are the short stretches of single stranded DNA used to detect the…
Q: What are the particular changes in the gene and protein sequences shown on the screen? Name the…
A: Mutation is the sudden change of a gene or chromosome from one to another. position 3 wild type…
Q: contrast to white rice. Using recmbinant technology, golden rice is created by added two new…
A: There are six steps involved in rDNA technology. These are – isolating genetic material, restriction…
Q: From your knowledge about DNA microarray, answer the following: Mention the name and the color of…
A: DNA microarray is basically a collection of microscopic DNA spots that are attached to the solid…
Q: When you know the sequence of the gene for the ocular protein where would you get the DNA you need…
A: The cloning is the method of recombinant DNA technology in which a piece of known DNA sequence is…
Q: Why is it helpful to use a computer program to translatea genetic sequence rather than doing it by…
A: the benefits are:
Q: List three independent techniques you could use toidentify DNA sequences encoding human geneswithin…
A: A genome is referred to as genetic material of the organism that composed of DNA or RNA. The genome…
Q: CRISPR techniques allow scientists to modify specific genes while sparing all others, thus…
A: Genetic diseases are the hereditary diseases that are very difficult to treat. With the advancement…
Q: Sanger sequencing Write a precise and accurate differential report on the above sequencing…
A: DNA sequencing is the process of determining the sequence of nucleotides (As, Ts, Cs, and Gs) in a…
Q: What are the possible bioethical issues that gene editing tools may encounter?
A: Gene editing tools are used to edit an organisms genetic code , i.e.. with these tools ,the genetic…
Q: What are gene microarrays? How are microarrays used?
A: The process of forming a single double-stranded nucleic acid molecule by combining two…
Q: What provides a convenient bridge between the low resolution of a karyotype and the ultra-high…
A: Introduction Cytology refers to the study of cell such as cell morphology, physiology etc. As we…
Q: Explain the basic techniques used to manipulate genetic material
A: Genetic Material: A cell or an organism comprises information carrier materials found in the…
Q: A DNAR document is legally binding. True or False?
A:
Q: What is the difference between using genome build hg18 and hg19 in Genome-wide SNP arrays?
A: SNP (Single nucleotide protein) array is a type of DNA (deoxyribonucleic acid) microarray which is…
Q: How to use a microarray for transcriptome analysis ?
A: Transcriptome is the complete set of the mRNA molecules expressed in an individual . It is termed as…
Q: Briefly explain how synthetic probes are created to screen a DNA library when the protein encoded by…
A: Synthetic probe is fragment of DNA. to screen a DNA library RNA of variable length approximately 100…
Q: explain the similarities and differences between the methods used in transcriptomics and genomics
A: Genomics is the study of genomes through analysis, sequencing and mapping of genes and…
Q: process of overlap assembly in whole genome sequencing
A: Genome sequencing Genome sequencing or gene sequencing is a way of arranging nucleotides the n the…
Q: Following PCR amplification of a disease gene, you perform sequence analysis using a primer 20…
A: After performing sequencing through gel electrophoresis DNA fragments are organized according to…
Q: Identify the mRNA sequence that encodes the protein Design primers that will allow them to amplify…
A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…
Q: How would you simply explain Protein Analysis (Western blotting)?
A: Proteins, also known as polypeptides, are made up of amino acids. They’re large, complex molecules…
Q: SANGER SEQUENCING NEXT GENERATION SEQUENCING WRITE A PRECISE AND ACCURATE DIFFERENTIAL REPORT ON…
A: sanger sequencing and next-gen sequencing is that the sanger method only sequences a single DNA…
Q: Describe the outcome of a chain-terminator sequencing procedure in which (a) too few primers are…
A: Chain terminating sequencing is also known as Sanger sequencing which is based on amplification of…
Q: Outline different strategies for identifying gene sequences.
A: Genome is the study of all genes present in the organism. Gene is a unit of heredity that is…
Q: Give a step by step method and diagram of how reversible terminator sequencing works.
A: The reversible terminator sequencing or Illumina dye sequencing is a technique used to determine the…
Q: Describe the outcome of a chain-terminator sequencing procedure in which (a) too little ddNTP is…
A: Sanger DNA sequencing is also known as the sequencing process of chain-termination. In addition to…
Q: Explain the relationship among the following terms: genomics, proteomics, gene, protein, genotype,…
A: Introduction :- Genomics is the study of an organism's entire genome, which includes genetic…
Q: Explain how substitution matrices can be used to improve the possibility of identifying related…
A: Protein is a macronutrient that is vital for building muscle mass. It is normally found in creature…
Q: Using the 5 major steps, make or create your own flow diagram of the genetic engineering process
A: Flow diagram of genetic engineering processes :-
Q: Why is it necessary to examine gene-expression profiles, in additionto genome sequences, for…
A: Gene expression profiling is the analysis of the behaviour of thousands of genes at once to…
Q: Consider the following wild-type and mutant sequences:Wild-type ....CTTGCAAGCGAATC....Mutant…
A: Introduction A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of…
Q: gene definition
A: Allele are considered as the variant of the gene. DNA is composed of different nucleotides that…
Q: Refer to the figure. What method would you use if you wanted to determine the sequence of the cDNA…
A: cDNA is complementary DNA. This DNA is artificially synthesized from the mRNA template. In genetic…
Q: Hi, I would like to know which program is used for the graphical presentation of the results of a…
A: A genome wide linkage association study (GWAS) is an approach used in genetic research to associate…
Q: Describe the methodology behind sanger sequencing techniques
A: Sanger Sequencing techniques is a method of DNA sequencing. It was first developed by Frederick…
Q: What is the results of extracting the DNA of a strawberry?
A: Ripe strawberries are an excellent source for extracting DNA because they are easy to pulverize and…
Q: Describe how lon torren method of sequencing works in detail.
A: Thermo Fisher Scientific's Ion Torrent technology introduces a completely new approach to Next…
Q: In Northern and Western blotting, what is the purpose of gel electrophoresis?
A: Blots are strategies for moving DNA (deoxyribonucleic corrosive), RNA (ribonucleic) and proteins…
Q: Briefly explain why RNA-seq gives more information about the transcriptome than does microarray…
A: Messenger (m-RNA) ribonucleic acid is known to be transcribed from the DNA molecule, which is the…
Q: Describe how Ion torren method of sequencing works in detail.
A: Thermo Fisher Scientific's Ion Torrent technology brings a whole new method to Next Generation…
Q: In your own words, describe the series of steps necessary to clone a gene.
A: Cloning is the process of producing genetically identical copies of an individual by natural or…
Q: To achieve a 10x depth coverage for a genome of length 10 Mbp, how many reads of 100 bp are…
A: A Coverage is multiplier based on total size of the genome. Formula = Coverage = (read length) x…
Q: Why is genome editing by CRISPR-Cas advantageous over traditionalmethods for creating knockout or…
A: Two crucial components make up the CRISPR-Cas9 system, which modifies DNA. These include the Cas9…
Q: If you have access to the necessary computer software, make asequence file and analyze it in the…
A: The sequencing of genetic information is important for proper study and analysis, and with the…
Q: Which of the following pieces of information about our recombinant DHFR protein do you predict to…
A: Western Blotting Technique is a common procedure for the detection and analysis of proteins. It is…
Step by step
Solved in 2 steps
- If you have access to the necessary computer software, make asequence file and analyze it in the following ways: What is thetranslated sequence in all three reading frames? What is the longest open reading frame? Is the sequence homologous to any known sequences? If so, does this provide any clues about the function of the sequence?Both microarray and RNA-sequencing can study the transcriptomes. Compare microarray and RNA sequencing technique in analyzing gene with high, medium and low copy number of genes.Hi, I would like to know which program is used for the graphical presentation of the results of a meta-analysis of genome-wide linkage scans?
- Which sequence variations are identified by NGS and in which format they are store Discuss in details the software used to identify the effect or nature of these variants. How this information can be used for personalized medicine.Align two sequences: horizontal – GGAATGG, vertical – ATG, m=1, mm = 0, g=-1. Use the table below for the NW matrix. Write down and score all optimal global alignments. Complete the NW matrix below and show the alignment paths. Use the arrows and circles for the matrix and paths. Click the shapes and move them using your keyboard arrow keys (or drag). Click the shapes and then right-click to copy/paste or click and use Ctrl + C to copy, then Ctrl + V to paste (in Windows MS Word). 0000 Align and score 4 optimal alignments here. the first line, v sequence in the second line and Each alignment should have h sequence individual scores for each alignment position in the third line.What is a read (Sanger sequencing)?
- Explain the basic techniques used to manipulate genetic materialFrom the results of your BLAST search you can link to the GENE entry for one of your top hits. This link is located under the “Related Information” heading at the right hand side of each displayed alignment (i.e. scroll down to the “Alignments” section). QUESTION What is the “Official Symbol” and “Official Full Name” for this gene?Sanger sequencing originally used 4 lanes in gels. These lanes represented sequences of different lengths obtained by adding:
- Computate bioinformatically the Tm value, the GC-content of the selected DNA sequence and the absolute nucleotide composition of the selected gene. Please provide also the tool source of the computation. Sickle Cell Anemia is the disease being used. Please answer the question using sickle cell anemiaDesign a oligonucleotide probe for provided gene sequence using all the guidelines for efficient probe designing. ACAACCCCAAGCCTTCAACCACCCCCTTCCCCCAAATTAGAGATCGATCTCAAGAAGAAGAATGGGTTCCGTCTCTCGCTCTTCTTTGGATCAGAAGCTGGCCATGGCAAAGCGCTGCTCCCACGAGGGAGTTGTCGCGGGAGCAAAGGCGGCCGTGGTTGCAACTGTTGCCTCGGCCATTCCTACTTTGGCTAGCGTTAGGATGATCCCATGGGCGAGGTCCTTCCTTAATCCCGCAGCTCAGGCCCTCATCGTTTCATCAGCGGCGGGGGCGGCGTACTTCATAGTTGCGGACAAGACDescribe the main technique for amplifying a segment of DNA (like the one you suspect is involved in Lee’s cancer) from a complex mixture of genomic DNA. Remember that the entire human genome sequence is known. (Hint: This is a technique that is commonly used by laboratories that do genetic testing and various other applications of molecular biology.)