THCA 100 This reaction is Entropy is THC ( Leafly Mur AD RNA polymerase ATGACGOATCAGCCOCAAG GOAATTGOOGACATAA VACUOCCUAQUCOGCQUU RNA Transorpt TAUTOCOTAGTCOD 99 ATTEOR TATT (In this picture, RNA is being made by complementary base pairing with DNA.) This reaction is Entropy is
Q: You are supplied with an unknown protein that consists of more than 130 amino acids. Furthermore…
A: The primary structure of a protein is the amino acid sequence of the protein. According to…
Q: You apply a new drug to a different batch of neurons and record membrane potential changes in the…
A: Permeability barrier and semi permeability of cell membrane are both maintained by lipids. only…
Q: Authophagy refers to naturally regulated mechanisms of degradation and removal of dysfunctional…
A: Denaturation is the phenomenon through which proteins or nucleic acids loses their native…
Q: A DNA molecule rich in C-G base pairs will have less hydrogen bonds between its two strands compared…
A: DNA, as well as RNA, belongs to the class of macromolecules. They are known to store genetic…
Q: 4. Which of the following is the CORRECT pair of a protein and its function? * A. Hemoglobin: helps…
A: Proteins are biomolecules composed of amino acid units. Proteins are the building blocks of the…
Q: Vitamin A's two best studied forms and functions are both rhodopsin action and gene expression…
A: Vitamin A is a fat soluble vitamin. This vitamin can be reversibly converted to the aldehyde…
Q: Explain how the structure of an enzyme in which two domains each have some affinity for a substrate…
A: Enzymes are proteins produced by living organisms to catalyze specific metabolic and biochemical…
Q: What is the actual meaning of Biocompatible and biodegrable for the scaffolds for biomedical…
A: The property of material compatible with living tissue is called biocompatibility. Biocompatible…
Q: Modify isoleucine to show the predominant forms at pH 1, 7, and 13. Isoleucine has pK, values of 2.4…
A: Proteins are polymer of amino acids , and each of the amino acid residue is linked to its…
Q: What is the role of the heme prosthetic group in hemoglobin? A. The heme group coordinates the…
A: Heme : It is iron containing molecule being important for the biological processes. 1 hemoglobin…
Q: What is the relationship of the new DNA chain of a daughter DNA double helix and the old DNA chain…
A: The mode of replication of DNA in living organisms occurs in a semi conservative manner. Each of the…
Q: Question #3 Complex III (cytochrome bc₁ complex) in the electron transport chain transfers electrons…
A: Hi! Thank you for the question. We are authorized to answer one question at a time, since you have…
Q: Question #5 5A. Draw a triglyceride with one polyunsaturated fatty acid acid (12 carbons), one…
A: Lipid are actually the cellular components that form insoluble part of cell having large diversity…
Q: Ferritin is a blood plasma iron transport protein O True O False
A: Iron (Fe) is very important in our body as it acts as cofactor. When iron enters the cells of our…
Q: Draw the structure of triglyceride containing the fatty acids palmitic, oleic, and linoleic. How…
A: Triglycerides are typically made of a glycerol backbone along with three fatty acids bonded to the…
Q: The image below shows the different interactions responsible for the spontaneous folding of a…
A: According to Anfinsen's hypothesis the sequence or primary structure of a protein f=determines the…
Q: Illustrate the biochemical pathways for one complete cycle of b-oxidation of fatty acyl CoA (giving…
A: Beta oxidation is a biochemical process in eokaryotes by which fatty acids broken down in cytosol.…
Q: Lactate dehydrogenase (LDH) plays an essential role in an exercising muscle, especially when the…
A: During cellular respiration, respiratory substrates like glucose may undergo complete or…
Q: Use the table of the codons to answer the following question. Starting with the start codon, what is…
A: A codon is a sequence of three consecutive nucleotides in a DNA or RNA molecule that codes for a…
Q: 111 The Michaelis constant is represented by what variable, and is comprised of which rate constants…
A: Michaelis constant is a quite important term as it is used for determining the concentration of any…
Q: Many common household cleaners, such as stain removers, are based on the use of polar and non-polar…
A: Household cleaners are basically used to clean the stain and dirt. Non-polar is generally dissolved…
Q: Number of hydrogen bonds between adenine and thymine? * O (a) 1 (b) 2 O (c) 3 (d) 4
A: There are five nitrogenous bases (adenine, thymine, guanine, cytosine and uracil) and paired with…
Q: polymers have a similar composition to that of common carbohydrates (predominantly composed of…
A: Carbohydrates are oraganic biomolecule consists of Carbon, Hydrogen and Oxygen atom with a chemical…
Q: The reaction of glutamate and NH4* to yield glutamine is catalyzed by a) Uridylyltransferase b)…
A: Glutamine and glutamate are important amino acids for the metabolism of body. Though they are not…
Q: The ATP yield from TCA cycle starting with two molecules of acetyl CoA is....... a) 15 ATP. b) 24…
A: Introduction: TCA cycle which is also known as the Kreb cycle is the last common oxidative pathway…
Q: a newly-developed drug is found to bind to acetylcholine receptors but does not activate them, the…
A: Introduction: Some drugs are designed to produce an opposing reaction when bound with the receptor…
Q: What is the predominant 2° structure in this figure? O alpha helix Obeta sheet O gamma-globulin O…
A: Proteins are composed of amino acids. They are linked together by peptide linkages. Proteins have…
Q: A peptide has the following sequence: Gly-Ala-Lys-Phe-Asp-Met-Val-Pro-Arg-Ala-Leu. What is the net…
A: The amino acids contain ionizable groups. The ionic form and charge of the amino acids depend upon…
Q: OH 9. Complete the following reaction by drawing the molecular structure of the main product. Label…
A: Introduction: Disaccharides are formed when two monosaccharides are joined together and a molecule…
Q: Follow the instructions. Typewritten for an upvote. No upvote for handwritten. PLEASE SKIP IF YOU…
A: Entropy is the measure of disorderness or randomness of any substance on the basis of phase…
Q: The equilbrium constant (Keq) under standard conditions for the hydrolysis of ATP is 200,000 M. This…
A: The Gibbs free energy of a system is defined as the enthalpy of the system minus the product of the…
Q: An intermediate of the citric acid cycle that undergoes reductive amination with glutamine as…
A: Citric acid cycle is the second stage of cellular respiration that occurs in mitochondrial matrix…
Q: The RNA transcript is complementary to the sense strand. Group of answer choices True False
A: The RNA or ribonucleotide is formed by the process of transcription using DNA as template.
Q: What will happen if the enzyme renin is mixed with 1N HCL before adding milk?
A: Rennin is a proteolytic enzyme or protein digesting enzyme also know as chymosin.
Q: . When digesting a complex carbohydrate, water is added and, a simple sugar is obtained through…
A: During digestion the large molecules are broken down into simple molecules like during protein…
Q: In the Watson-Crick structure of DNA, the: a. adenine content of one strand must equal the thymine…
A: Watson and Crick model of DNA has two strands that wound around each other and form double hellicle…
Q: The image below shows the different interactions responsible for the spontaneous folding of a…
A: Protein protein interactions are of different kinds, they are responsible for holding the protein…
Q: antibiotics that bind to 30S ribosomal subunit trimetjoprime chloramphenicol sulfonamide…
A: Antibiotics affect the growth of bacteria by inhibiting various metabolic pathways, replication,…
Q: what is the purpose of this experiment Effect of Temperature on the Hydrolysis of Starc
A: Introduction: Enzymes are proteins that act as biological catalysts to fasten the rate of the…
Q: What do you mean by food additives? What are the categories of food additives based on their…
A: Food is an essential part of our diets. There are many types of food such as freshly prepared in the…
Q: Proteins often have regions that show specific, coherent patterns of folding or function. These…
A: Proteins are polymers of amino acids linked by peptide or amide bond between carboxyl group of one…
Q: Lactose intolerance is a genetically-based food allergy O True O False
A: Lactose intolerance is a condition in which the person is unable to digest the lactose which is…
Q: The three-dimensional structure of DNA is said to be maintained by the presence of many hydrogen…
A: The biochemical basis of heredity is DNA. It is widely recognized as the genetic data reserve bank.…
Q: give the significance/role/effect of the reagent/condition in the isolation or analysis of a…
A: Deoxy ribonucleic acid (DNA) is the genetic material of the cell which carries the information on…
Q: You've discovered a new gene, G8R. Describe two experiments you could do to determine whether it is…
A: As you have discovered a new gene, G8R, the sequence would be known to you. There are certain…
Q: give the significance/role/effect of the reagent/condition in the isolation or analysis of a…
A: saponification is a process of formation of metallic salt of fatty acids i.e. ester bond between FA…
Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…
A: Given mRNA sequence is 5'-GCAAGUCUUAAU-3'. Ans 1. Three consecutive nucleotide codons translate into…
Q: METHOD: Pass a piece of bread around the house and let everyone in your house touch it. Then place…
A: Microbes are tiny living organism present everywhere around us. The microbial spores or endospores…
Q: Compare/contrast the structures of the following carbohydrate pairs: (a) D-ribose and D-ribulose…
A: Carbohydrates or carbs are macronutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: Please help me I really a comprehensive explanation please help. Talk about covid and why it’s a…
A: Covid occurs by a very deadly virus that has the ability to affect different people in distinct…
![of
estion
9
t of
uestion
THCA
▶
Sou
100-
HC
This reaction is
Entropy is
THC
San
Leafly
ATA
RNA polymerase
SSSSSSSSSS
ATTOGOGACATAA
ATGACGGATCAGCCOCAAG
UACUOCCUAGUC
RNA Transcript
TACTOCCTAGTCGGCOTTCOOCTTAACCOCTOTATIT
(In this picture, RNA is being made by complementary base pairing with DNA.)
This reaction is
→
Entropy is
◆](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2Fadcdbcca-c3a9-4ed7-8010-bf988080b342%2F566bf13e-a8e8-48f0-8b8c-cdeacd38d2d7%2F4mkvh06_processed.jpeg&w=3840&q=75)
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’ Write down the mRNA transcript from DNA above.Based on sequences A,B,C. Provide an anticodon sequence that would build this protein. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGG
- EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGCName: Date: 2. The sequence of a fragment of one strand of DNA is AATTGCATATACGGGAAATACGACCGG. Transcribe this s sequence into MRNA. er bns eldst eboo oi ebitqeqylog erlt to noihiog eri qu elsm bluow tsri abios onime Jlaw as ye s 1ot noitem atelomet AHG 3. The following MRNA ştrand is being used to asemble a polyp
- BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of mutation is this? UUU U UUC UUA UCU Phe UCC UAU UGU Cys ANTISENSE 5' GGACCCTAT3' UAC Tyr UGC UAA Stop UGA Stop UAG Stop UGG Trp Ser UCA Leu UUGL" UCG CUU CU CAU) His CAC) CGU CGC CGA Arg CUC C Leu Pro CAA1 Gin CAG) CUA CCA CUG CG CGG AAU AAC Asn AGC AAA AAG Lys AGG Arg AUU ACU AGU Ser AUC lle ACC Thr AUA ACA AGA AUG Met ACG GCU GCC GUU GAU] GGU GUC Val GAC Asp GGC Ala Gly GUA GCA GAA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a FRAMESHIFT SILENT NONSENSE MISSENSE Third letter First letterThis is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: bottom strand is the noncoding strand). 5'-ААCGCATGAGAAAGCCCCCCGGAAGATCACСТТСCGGGGGCТТТАТАТААТТАGC-3' 3'-тTGCGTACтстттCGGGGGGCCTTCTAGTGGAAGGCCCCCGАААТАТАТТААТтCG-5' (i) Draw the structure of hairpin loop that will be formed during transcription. (ii) Illustrate how the hairpin loop structure initiates the termination of transcription.
- 5-ccuaaucg-34 3'-acctgcctataccggattagetetgatectaagcatgtc-5 The diagram above shows an RNA primer hydrogen-bonded to a DNA template. Which letter indicates the site where DNA polymerase would add nucleotides to this structure? OA OB D Any of these is possible C5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU UCC Leu UCA UCG U UUC UUA UUG CUU C CUC CUA CUG AUU A AUC AUA AUG U GUU G GUC GUA GUG CCU Leu CCC CCA CCG ACU lle ACC ACA Met ACG GCU Val GCC GCA GCG с Second Letter Ser Pro Thr Ala UAU UAC A | AAU AAC AAA AAG GAU GAC GAA GAG Tyr CAU CAC CAA Gin CAG 1 UAA Stop UGA Stop A UAG Stop UGG Trp G His Lys UGU UGC Asp Glu G 3rd Asn AGU Ser U letter AGC AGA AGG Cys U CGU CGC Arg CGA CGG GGU GGC GGA GGG DCAG DUAG DUCAG Arg Gly UCAG5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCC Find start codon and stop codon UACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACG ACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGC UGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGA GGUAGAAGCCGCUGGGGCUUGGGGCU-3’
![Biochemistry](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
![Biochemistry](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)