Q: The Earth’s atmosphere consists of 78% nitrogen. Why do you think that plants and animals can’t use…
A: Earth’s atmosphere contains a huge amount of nitrogen gas. But this nitrogen is unavailable to…
Q: Having the ability to degrade the DNA allows the DNA polymerase to perform its job properly and…
A: Answer :- True. - It is true that having the ability to degrade the DNA allows the DNA polymerase to…
Q: I understand how nuclear factor-kB (NFKB) works in the inflammatory response but what is the…
A: NFKB is a transcription regulator that is activated by cytokines, oxidant-free radicals, ultraviolet…
Q: Question 3 What are the diseases associated with hypocomplementaemia and which complement deficiency…
A: * Hypo complementaemia can be referred as decreased complement levels and secondary complement…
Q: A child could have the same blood type as one of his/her parents but it doesn't always happen that…
A: Blood types are the result of the presence or absence of antigens on the surface of the individuals…
Q: Q.3. Explain the terms: 1. Race 2. Breed 3. Cultivars 4. Variety
A: Animal husbandry is the department of science that deals with the exercise of breeding, farming, and…
Q: Polyunsaturated lipids are liquid at room temperature because they have ______ in their fatty acid…
A: Lipids are the fats and are basically biological macromolecule that play very important role in…
Q: Explain Down's syndrome.
A: Introduction In this question we will discuss about the Down's syndrome.
Q: Which of the following helps Human sperm with locomotion? a) Flagellum ) Rasal hody.
A: Sperm cells are small, mobile cells produced in large quantities by the male reproductive system.…
Q: what ate the 3 levels of biological organization of E.coli? Please answer asap and type your answer…
A: First let's discuss what is levels of biological organization, Living things are organized into…
Q: How the presence of Pseudomonas aeruginosa in lungs aggravate the condition of patient having Cystic…
A: The airways of patients with cystic fibrosis (CF) are exceptionally complicated, concerned with…
Q: In microscopy, what could be the possible reason why we cannot completely resolve the specimen under…
A: A microscope is a lab instrument used to examine the objects that are too small to be seen by the…
Q: What are homologous chromosomes? Which are the human cells that do not have homologous chromosomes?
A: Introduction - Chromosomes are thread-like structures that reside within the nucleus of animal and…
Q: .Define autosome, hemizygous, homozygous, and heterozygous?
A: Autosome- All chromosomes, with the exception of the sex chromosomes, are referred to as Autosomes.…
Q: 3. Compute for the amount of each component of KCN broth if you were to prepare 280 ml. Express your…
A: Different components are required in exact amounts to make a working solution or broth as needed by…
Q: Darwin based his Theory of Evolution by Natural Selection on series of observations. Which of the…
A: In today's world when a pandemic spreads those who have strong immunity could survive and could be…
Q: Prepare a table to show the levels of organization specifying the examples per level.
A:
Q: Cuvier's idea of catastrophe related to asteroid collisions understanding that geological change…
A: Theory of catastrophes by George's Cuvier According to this theory, fossil show that animal and…
Q: What similarities and what differences between the graphs? What antibiotics were the most…
A: These graphs are based on the observation of bacteria collected from cave and were tested for…
Q: Why are older expectant mothers routinely given amniocentesis or CVS?
A: Prenatal diagnostic procedures such as chorionic villus sampling (CVS) and amniocentesis are used to…
Q: Two eukaryotic genes (A and B) are involved in two different metabolic pathways, and each has a…
A: Transcription elements are proteins that modify the transcription of genes, ie. Their copying into…
Q: You are studying energy production and metabolic activities of prostate cancer cells in the lab. You…
A:
Q: List the characteristics of fossils.
A: The following are some of the characteristics of fossilised organisms:
Q: A. Answer the following questions briefly 1. How does the body react to protect itself from…
A: Answer
Q: (b) How is ATP converted to ADP by glucose? Explain. Why is there no intake of phosphoric acid by…
A: ATP is converted into glucose by cellular respiration. Glucose is completely oxidised into carbon di…
Q: Question 1: You suspect that a patient has sepsis. A. What type of specimen would you collect to…
A: *NOTE: Kindly repost for other question Dear Student as per the guidelines we are supposed to answer…
Q: born with sickle cell anemia. What is the frequency of individuals in this population who do not…
A:
Q: Explain rna splicing in eukaryotes
A: The "translation" is the process through which mRNA codes for a certain protein. The ribosome…
Q: Chapter 23- Diseases of the Digestive System Match the description on the left side to the correct…
A: INTRODUCTION Answer to the question 41-50 is given below.
Q: 13. Compare the cells in the two photomicrographs below in terms of their shape and structure(s). А…
A: A cell consists of three parts: the cell membrane, the nucleus, and, between the two, the cytoplasm.…
Q: Detoxification of lipid drugs and other harmful compounds in ER is carried out by? a) Cytochrome D…
A: Introduction - Detoxification is the process of removing a drug of dependency from the body without…
Q: Defining occupational health and safety and its importance in the work environment.
A: occupational health deals with all aspects of health and safety in the workplace and has a strong…
Q: What is a recombinant DNA vaccine? List two such vaccines. State their advantages.
A: Vaccines can be defined as biological preparations that help in building active adaptive immunity…
Q: How would you make a monoploid plantlet by startingwith a diploid plant?
A: Monoploid plants have a single pair of chromosomes in each cell, whereas diploid plants contain a…
Q: Summarize the passage “Walking and fat loss”., and describe the reasons why walking is not effective…
A: Walking is a shape of a low effect, moderate-intensity workout that has various health blessings and…
Q: Which of the following is required for RNA splicing to occur? A a free 5 hydroxyl created by…
A: In vertebrates, there are three signals for direct splicing: - 5/ splice site hydroxylation…
Q: In what way do systematists use shared derived characters in their work?
A: Synapomorphies characterize a specific set of groups, but not all members of a clade share the same…
Q: Directions: Read and understand the situation very carefully. Hanabi, a grade 12 student have…
A: The examination of the evolutionary development and connections among or even within groups of…
Q: John, a 47-year-old white male, weighs 86 kg and is 1.7 m tall. Calculate his body fat percentage…
A: Body Mass Index BMI is an indication of fatness in the body. It measures the body fat depending on…
Q: Vhat is the driving force behind divergent evolution? Explain.
A: Divergent evolution happens when a populace of animals or plants is parted into two gatherings by a…
Q: Which of the following would result in no movement (i.e. no activation of the mo cortex)?…
A:
Q: What is Sex-linkage?
A: Introduction In this question we will discuss about the sex linkage.
Q: Which of the following does NOT tend to promote genetic divergence between populations? a)…
A: The genetic diversity has three different sources: mutation, recombination and immigration of genes.
Q: Q.2. What are the criteria for selecting organisms to perform crosses to study the inheritance of a…
A: * genetic cross is mating of two individuals that results in the combination of genetic material in…
Q: Like nucleotides, amino acids have directionality in their back bone. While nucleic acids are…
A: Central dogma The process of translation of DNA into gene products is called the central dogma. It…
Q: (d) Why are omega-3 fatty acids called essential fatty acids? Provide the structure of any such…
A: The fatty acids are simplest form of lipids that contain long hydrocarbon chain. They are classified…
Q: Explain 4 patholigical features associated with each of the following diseases caused by parasite.…
A: trypanosomiasis, also known as sleeping sickness, is a vector-borne parasitic disease. It is caused…
Q: Which is a common cause for the production of oncogenes? a. defective ion channel proteins…
A: Cancer The continuous uncontrollable division of defective cell can leads to the cancer.
Q: Q.15. State the principle of vaccination. How can vaccines be used to prevent microbial infections?…
A: Introduction In this question we have to state the principle of vaccination.
Q: This figure can be used to represent the sequence of events leading to the evolution of dark-furred…
A: Evolution is the change in the characteristics of a species over several generations and relies on…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.A portion of the sequence from the DNA coding strand of the chick ovalbumin gene is shown. Determine the partial amino acid sequence of the encoded protein. CTCAGAGTTCACCATGGGCTCCATCGGTGCAGCAAGCATGGAA-(1104 bp)-TTCTTTGGCAGATGTGTTTCCCCTTAAAAAGAA Enter the 3-letter abbreviation for each amino acid in sequence, separated with dashes, and no spaces (example: xxx-xxx-XXX-XXX...) The amino acid sequence is .1104bp..…........
- A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)Consider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.What is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'
- Refer to the DNA sequence provided:3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNAin (a)? (The question for A is this: What is the mRNA transcript of the anticoding strand of the DNA model?)Using the genetic code table provided below, identify the open reading frame in this mRNA sequence, and write out the encoded 9 amino acid long peptide sequence: 5'- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU C A G U UUU Phe UCU Ser UUC Phe UCC Ser UAC UCA Ser UAA UCG Ser UAG UUA Leu Leu G C CUU Leu CUC Leu CCC CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met ACG ACU Thr ACC Thr ACA Thr Thr A UAU Tyr UGU Cys Tyr UGC Cys CCU Pro CAU His CGU Arg Pro CAC His Pro CAA Gln CGC Arg CGA Arg CCA CCG Pro CAG Gln CGG Arg GUU Val GCU Ala GAU GUC Val GCC Ala GAC GUA Val GCA Ala GAA GUG Val GCG Ala GAG Stop UGA Stop UGG AAU Asn AAC AAA AAG AGU Asn AGC G Lys Lys Asp Asp Glu Glu Stop A Trp Ser Ser AGA Arg AGG Arg GGU Gly GGC Gly UCAG GGA Gly GGG Gly с U C A G U C A G U C A GComplete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino Acid
- Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’For each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino Acid