Predict the resulting DNA strand in the presence of a mutagen that causes the ADDITION of one Cytosine in the N-terminal of DNA----TAG TAC TAG T --Normal DNA strand TAG TAG TAT C TAG TAT CAG T CTA TAC TAG T TAG TAG AGC T

Predict the resulting DNA strand in the presence of a mutagen that causes the ADDITION of one Cytosine in the N-terminal of DNA----TAG TAC TAG T --Normal DNA strand TAG TAG TAT C TAG TAT CAG T CTA TAC TAG T TAG TAG AGC T

Name: Predict the resulting DNA strand in the presence of a mutagen that cau
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Predict the resulting DNA strand in the presence of a mutagen that causes the ADDITION of one Cytosine in the N-terminal of DNA----TAG TAC TAG T --Normal DNA strand TAG TAG TAT C TAG TAT CAG T CTA TAC TAG T TAG TAG AGC T

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Provide the complementary strand and the RNA transcription product for the following DNA template segment:5'-AGGGGCCGTTATCGTT-3'
The sequence below is of the DNA duplex for a gene in which transcription begins with the nucleotide highlighted by the arrow. If the upper strand shown is the template strand, write the sequence you expect for the mRNA transcribed from this gene. Please write 5' to 3'. 5'-[x]-3' 5'-TACGTGACGGTAATACTAGC-3' 3'-ATGCACTGCCATTATGATCG-5'
Below are several DNA sequences that are mutated compared with the wild-type sequence. Eachis a section of a DNA molecule that has separated in preparation for transcription, so you are onlyseeing the template strand. For each mutated DNA sequence, translate and record the resultingamino acid sequence. What type of mutation is each? Wild-type sequence: 3’-T A C T G A C T G A C G A T C-5’ Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #2: 3’-T A C G G A C T G A C G A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #3: 3’-T A C T G A C T G A C T A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #4: 3’-T A C G A C T G A C T A T C-5’Amino acid sequence of peptide:Type of mutation:
Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and with the correct 5' and 3' ends. DNA: 5'-ATAGGGCATGT-3' 3'-TATCCCGTACA-5' <--- template strand Group of answer choices 5'-ATAGGGCATGT-3' 3'-UAUCCCGUACA-5' 5'-AUAGGGCAUGU-3' 3'-TATCCCGTACA-5'
Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…
How does one label the DNA-strands that look like this--------------------------------------------and mark the four ends with correct designations.The DNA-strand does contain a gene. In and around the gene sequence, mark the following areas with Exon Poly A tail addition signal Promoter Starcodon Introns Stop codon Does the gene from the drawing come from a pro- or a eukaryotic organism?
#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
The X's correspond to the missing information. You need to determine what those X's represent DNA STRAND: XXX-CCC-GGG-GCG-XXX-XXX-XXX-GCC-ATA-TTA-XXX RNA STRAND: XXX-XXX-XXX-XXX-XXX-XXX-XXX-XXX-XXX-XXX-XXX PROTEIN: Met - X - X-X - Thr - Val - Glu-X-X-X - Trp To be clear, your answer is just the 3 sequences above without the X's (the highlighted yellow parts). There may be more than 1 correct answer for some parts of this assignment. Any answer your choose is fine. If you are unclear on how there could be more than 1 correct answer, review the lecture related to protein translation. Provide me with the: 1. Complete DNA sequence of 33 nucleotides 2. Complete RNA sequence of 33 nucleotides 3. 11 amino acids
In relation to central dogma of molecular biology answer the following questions: The following segment of DNA is part of the transcription unit of a gene. You know already that RNA polymerase moves in a specific direction along this piece of DNA to convert one of the DNA strands into a single strand RNA transcript so that this entire region of DNA is made into RNA. 5′-GGCATGGCAATATTGTAGTA-3′ 3′-CCGTACCGTTATAACATCAT-5′ Given this information, a student claims that the RNA produced from this DNA is: 3′-GGCATGGCAATATTGTAGTA-5′ Give two reasons why this answer is incorrect.
Complete the table below 6. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’-T A C T G A C T GA C G A T C-5’. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence, then transcribe (indicating 5’ and 3’ ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid sequence (indicating the N and C termini). What type of mutation is each?6.a. Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’Complementary DNA sequence:mRNA sequence transcribed from template:Amino acid sequence of peptide:Type of mutation: 6.b. Mutated DNA Template Strand #2: 3’-T A C G G A C T G A C G A T C-5’Complementary DNA sequence:mRNA sequence transcribed from template:Amino acid sequence of peptide:Type of…
(11) If you design a gRNA with the sequence, GGU AUC AUU GCA CUG ACC AG, in theory which position of the nucleotide in the genomic DNA sequence below will be cut by Cas9 protein, which may lead to a knockout due to an error in DNA repair? The starting and the end coordinate positions of the DNA fragment on the chromosome are indicated at the beginning and end of the sequence, respectively. 110,001 ATC GGT ATC ATT GCA CTG ACC AGA GGC TAC 110,030 A) Between 110,023 (G) and 110,024 (A) B) Between 110,021 (C) and 110,022 (A) C) Between 110,020 (C) and 110,021 (C) D) Between 110,009 (C) and 110,010 (A)
GIVEN THE FOLLOWING DNA SEQUENCES (+) OF THE GENBANK: INDICATE WHICH IS THE TEMPLATE MOLECULE, WHICH IS THE mRNA AND THE POLYPEPTIDE THAT IS FORMED FROM THE SEQUENCE DNA 5' atgagtaaagga 3'