What is shown in the image below? RevienBiology SY21-22 / 2 of 25NucleusRoughERGolgiapparatusPlasmamembraneVesicleDE

Vesicles are involved in the transport of materials to and forth from the plasma membrane into the…

Answered: Nucleus Rough ER Golgi apparatus Plasma…

Science

Biology

Nucleus Rough ER Golgi apparatus Plasma Vesicle membrane

Essentials of Pharmacology for Health Professions

7th Edition

ISBN:9781305441620

Author:WOODROW

Publisher:WOODROW

Chapter5: Abbreviations And Systems Of Measurement

Section: Chapter Questions

Problem 5CRQ

See similar textbooks

Related questions

Q: Does a shoot need to include a stem? Could a plant perform photosynthesis successfully with its leav...

A: plant anatomy-is the subject to study the internal parts & processes of plants. photosynthesis ...

Q: How does myosin convert the chemical energy released by ATP hydrolysis into mechanical work?

A: Muscles are structures capable of changing their length in response to a stimulus.

Q: 13. Cervical spine 14. Lung radiographs 15. Diaphragm radiographs

A: Cervical spine : * patient position should be erect in AP view position and shoulders at equal dist...

Q: Complete dominance at both gene pairs but the first gene when recessive is epistatic to the second g...

A: Epistasis is an interaction that occurs at a phenotypic level and is governed by genotypic interacti...

Q: Imagine that ferredoxin is no longer able to participate in cyclic electron flow but is otherwise un...

A: Introduction : In case of photosynthesis, two type of light reaction present. Cyclic reaction ...

Q: 5. creates proteins from all amino acids an representing the protein. A. mitochondria B. ribosomes C...

A: Ribosomes are the proteins factory of the cell. Along with its association with tRNA and other cellu...

Q: How can I simplify the procedure section to be prepared for lab without having to refer to the lab m...

A: The procedure can be simplified into five simple steps, Preparation of NiCl2 and NaOH ( 5 mL each) ...

Q: What event/s during meiosis is simulated by the flipping of the coin? Explain these events briefly. ...

A: Probability is the possibility of a particular result occurring. For instance, what is the probabili...

Q: Which two animals are most closely related? Common Name Zebra Rhinoceros Wolf Horse Kingdom Phylum C...

A: Taxonomy is the study of organism categorization, it is the grouping (division) of all known species...

Q: Breastfeeding is an example of which of the following types of immunity? View Available Hint(s) for...

A: Breast milk is a rich source of Ig-A and Ig-G. These are antibodies which are required for fighting ...

Q: What cellular structure protects bacteria from drying out? Peptidoglycan Glycocalyx Fimbriae Cytopla...

A: Bacteria are single celled microorganisms, Which can't alive in a dry surface with a humidity or moi...

Q: A gene, which we will call gene C, can be epigenetically modified in such a way that its expression ...

A: Introduction: Gene is the structural and functional unit of inheritance or heredity which transfers ...

Q: containing two alleles that are the same for a trait 8. homozygous the allele that is only 9. F1 gen...

A: A trait is a characteristic feature that is unique to particular individual . These traits are expre...

Q: . A second feature that virtually all plasmid vectors havein common is the selectable marker. Explai...

A: Plasmids are the cloning vectors present in bacterial cells.

Q: 47. True of mitosis except: A. is the process by which a eukaryotic cell separates the chromosomes i...

A: Mitosis is the complete process of separation of nucleus as well as cytoplasm and other cell organel...

Q: Flowering Plants Flowers / Double Fertilization / Endosperm / Fruit Gymnosperms Ferns Mosses and Hor...

A: This picture depicts plant evolution. This diagram is called as phylogenetic tree.

Q: In a population of pea plants, there were 20 pea plants with white flowers (pp), 160 were heterozygo...

A: Hardy-Weinberg equation can be referred to as the calculation that can be utilized to find the popul...

Q: SEQUENCING Numbers 23 - 37 Correct Venipuncture Procedure: Syringe Method 23. Step 1 24. Step 2 25. ...

A: Venipuncture is a procedure of collection of blood from the vein using a needle. This process also u...

Q: do each strand of DNA have equal number of phosphate group

Q: The segment of DNA shown in the figure has restriction sites I and II, which create DNA restriction ...

A: The segment of DNA shown in the figure has restriction sites I and II, which create DNA restriction ...

Q: (a) (b) (c) The part of the illustration at the bottom (c) shows Initial inflation of the BP cuff O ...

A: Sphygmomanometer is the device used to measurement of blood pressure.

Q: Compare and contrast the use of the word recombinant asused in the phrases (a) “recombinant DNA” and...

A: Introduction:- Deoxyribonucleic acid, or DNA, is a molecule that contains the genetic instructions t...

Q: A genon wide analyst of human genome indicated that approximately 1500 genes encoded transcription f...

A: Transcription factors These are proteins that are involved in the process of transcribing the inform...

Q: Which of the following is not depicted in the diagram attached? A. Okazaki fragment B. Replication f...

A: Origin of replication is not depicted in the diagram. An origin of replication is a sequence of DNA ...

Q: b. Using a thin line, graph the relative amount of DNA per nucleus using the LEFT Y axis (G1, S and ...

A: Mitosis is a process of cell division that results in two daughter cells that are genetically identi...

Q: What is an endemic disease? A disease of which there are only a few scattered cases in a populatio...

A: Few disease only occurring in a particular area or may be it affect a large population. Usually this...

Q: White fruit color in summer squash is dependent on a dominant gene (W) and colored fruit to the rece...

A: Epistatic gene refers to a gene that suppresses the expression of another gene.

Q: Give 1 example of spectroscopic technique and discuss concepts involved and instrumentation.

A: The splitting of light into constituent colours is referred to as spectroscopy. In simple terms, it ...

Q: a. What type of inheritance is shown in the pedigree? 1 II 1 2 4 II 1 2 3 4 5 IV 1 Identify the geno...

A: Pedigree is a chart that represents members of a family affected by a genetic trait. Here, squares r...

Q: What is the F1 phenotyphic ratio of a cross between a black and white cats? Numerical anwers only. ...

A: Given, the Genotype of the black cat will be= BB, The genotype of white cat= bb and The Genotype of...

Q: 11-15. In humans, widow's peak (H) is dominant over a continuous hairline (h), and short fingers (F)...

A: In this conditions, widow's peak (H) is dominant over a continuous hairline (h) , and short fingers ...

Q: Suppose you have two rose plants, both with pink flowers. You cross the two plants and are surprised...

A: Introduction :- A flower is a reproductive structure found in flowering plants that is also known as...

Q: a. genotype of the parents b. Punnett square C. genotypic ratio d. phenotypic ratio

A: Here, based on the data given in the question Parents genotypes and phenotypes:- HhFf X HhFf (Widow'...

Q: Which of the following is true of the FoF1 ATPase under normal cellular conditions? Select all that ...

A: Introduction : FoF1 complex present in inner mitochondrial membrane and it can create ATP. FoF1 ...

Q: Complete dominance at both gene pairs but the first gene when dominant is cpistatic to the other. Du...

A: Introduction :- The effect of one allele in a heterozygous genotype entirely covers the effect of th...

Q: (B) Fill in the blanks (7 marks). Normal value (with unit) in a healthy individual Resting Stroke Vo...

A: Resting stroke volume: 1000 mL to 1700mL Resting cardiac output: 5-6 L/min. Resting arterial pressu...

Q: 2. Carefully analyze the following images. C (1 or 2 "sets" of information is held on how many chrom...

A: Introduction: The production of offspring by sexual reproduction includes the fusion of two gametes,...

Q: Which of the following is the most effective way to reduce the number of nosocomial infections? View...

A: An infection is the invasion of body tissues by disease-causing agents, their multiplication. The ho...

Q: Bacterial capsules work by _____. View Available Hint(s) for Part E protecting the bacterium f...

A: So correct option will be protecting the bacterium from engulfment Capsules made of substances occur...

Q: What is multiple cloning site ?

A: Introduction Molecular cloning is a set of molecular biology experimental methods for assembling rec...

Q: Explain the purpose of splicing the primary transcript and know the name of the ribonucleoprotein co...

A: Splicing makes genes more modular, allowing new combinations of exons to be created during evolution...

Q: Why do you have to reduce the amount of light with the diaphragm in order to see bacteria in a hangi...

A: Microscope diaphragm Diaphragm or iris of microscope is found at the base of the microscope whose m...

Q: 53. A eukaryote chromosome at metaphase consists of . A. naked DNA B. single stranded DNA C. two chr...

A: Mitosis consists of four phases i) Prophase ii) Metaphase iii) Anaphase iv) Telophase During Prophas...

Q: Consider the genes that specify the structure of hemoglobin. Arrange the following events in the mos...

A: Hemoglobin is present in red blood cells.Hemoglobin is made up of heme and oxygen molecule and respo...

Q: At least three hemoglobin alleles in human populations alterhemoglobin structure in such a way as to...

A: a sporozoan protozoan of the genus Plasmodium that is transmitted to humans or certain other mammals...

Q: The likelihood of co-transformation of two bacterial genes increases: a. As their distance apart on...

A: The transformation of a gene include the introduction of a foreign desired gene at the place of a pr...

Q: Explain to a friend the experimental strategy that was used to decipher the genetic code.

A: The genetic code involves the set of rules determining the conversion of nucleotide sequence into a ...

Q: . . Which is better indicator for Salmonella, coliforms or E. coli? Explain/defend your answer. .

A: Salmonella contamination is brought about by a group of salmonella bacteria called Salmonella. The m...

Q: Describe

A: The Mechanical isolation is the event that is found most commonly in the plants. For example, the ...

Q: 28. Which of the following statement is incorrect A. Not all organisms with the same genotype look o...

A: Answer :- Option (C) is correct. - Phenotypes result from the expression of an organisms genes as we...

Concept explainers

Substance Abuse

Substance abuse refers to the use of illegal drugs in excessive quantities, as well as the misuse of legal substances such as prescription or over-the-counter pharmaceuticals or alcohol for purposes other than those intended. Drug addiction, also known as substance use disorder, is a disease that affects the brain and behavior of a person. It leads to a failure to control the use of any drug or prescription, legal or illegal.

Question

What is shown in the image below?

Revien
Biology SY21-22 / 2 of 25
Nucleus
Rough
ER
Golgi
apparatus
Plasma
membrane
Vesicle
DE

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

DQuestien 6 What is Eas9 used for Aaturally by baEteria? Eitting viral BNA FEBlacing bactEFial gehes BrBdUEing texiRs duFing infection FansfEFFing geREs Frem BRE BaEteritim to anether
forboad-spectum cverge r se neumonia Heisunstade and apast serous) C Clulte C scatnine deance e Estimatea lanomycin manterance ose and ntenal for C Rund othe nere 20mg
enwen MADONA MED AND wens 926919 bifosloun 2 sdt ei nahe 915 21160 9eed spiros yn diw coriatum eninabe AMG n! urithwasdojem onin AVA nt 2 at 8 art nislqx3 zi cidT,AliQ to bre172 giggel eritel briste admun citas sepeb sabyg AMG The Mouble Ma C. Helix b. Uracil a. 3' end 5. For the following 3 terms: define, describe, and give an example if possible.
Part I – SymptomsCallie was 26 years old when she opened a bakery called “Callie’s Cupcakes” in downtown San Francisco with herf ancé, Jeremy. Despite the competitive market, her business was booming; everyone loved the clever recipes and thetrendy atmosphere. Between running their fast-growing business and planning for their wedding, Callie hadn’t beenable to keep to her usual eight hours of sleep a night. Although she had always lived a very healthy lifestyle, exercisingdaily and eating healthy, she just hadn’t been feeling herself lately. She was tired all the time, had dif culty breathing,felt stressed, coughed up sputum, consistently ran a low-grade fever, and had lost weight as her appetite decreased.None of these symptoms alone had been particularly alarming so she had put of seeing her physician for a few weeks.Questions1. What are Callie’s symptoms? List all that were mentioned.2. Based on the symptoms presented, what are three possible respiratory infectious diseases Callie…
Refer to the codon diagram on. Which of the following is a codon that will terminate translation? * Phe AGU Cys (C) G Trp (W) G UN A C C Arg (R) Leu (L) A Ser (S) Lys (K) A UG Asn (N) His (H) Thr Gin (Q) (T) Arg (R) lle (1) Ctart 是3 Met
4- Lacunae 3
10 diseases caused by staphylococcus
Which parasitic protist evades the host immune system by altering its surface proteins with each generation? Paramecium caudatum Trypanosoma brucei Plasmodium falciparum Phytophthora infestans
three portals entry of the disease breast cancer (excluding the genitourinary tract) Describe how microorganisms gain access thorugh each
Which enzymes in macrophages are important for clearing inti acellular bacteria? metabolic mitochondrial nuclear lysosomal
Bacillus subtilis dichotomous key
HindII --- 5' GTC - GAC 3', HaeIII --- 5' CC - GG 3', EcoRI --- 5' G - AATTC 3' and BamI --- 5' CCTAG - G 3' 5' AGAATTCTTACGCCGGACGTACCTAGGTTTAGTCGACTC CGCCGCCCCTAGGGTCATCA 3' 3' TCTTAAGAATGCGGCCTGCATGGATCCAAATCAGCTGAGGCGGCGGGGATCCCAGTAGT 5' Number of pieces of DNA , and blunt end fragment (s), and sticky end fragment(s)