Many dairy operations keep cow’s milk for sale and use formula to raise any calves. The farmer noted that calves raised on the formula needed to be treated for diarrhoea more frequently than calves left with their mothers to nurse. Explain this observation.

Q: Match the description on the left with the correct term on the right. Some answers may not be used.…

A: Match the correct term on the right to the correct description on the left.

Q: select all that apply Which of these experimental designs could help determine if the change in…

A: On the basis of the ways of maintaining the osmotic balance, animals can be divided into two…

Q: Which refers to the thickening and hardening of the arteries caused by plaque build-up?…

A: The hardening of the arteries occurs when fat, cholesterol, and other substances build up in the…

Q: Sulfamethoxazole is a type of sulfonamide antibiotic. Its absorbance ranges from 250-300 nm in a UV…

A: Sulfamethoxazole Sulfamethoxazole is a sulfonamide based bacteriostatic antibiotic, widely used to…

Q: Using CRISPR/Cas9 to target a gene in the mouse will primarily result in: a. Any of the choices b.…

A: CRISPR/Cas9 is a powerful tool that can be used to target and edit genes. This technology has a wide…

Q: A man feels a shooting pain in his arm, then a thundering in his chest.  Realizing that he is in the…

A: Heterologous expression is a process by which a host cell expresses a protein that isn't normally…

Q: What are some of the functional and evolutionary advantages of gnathostomes?

A: Gnathostomes are vertebrates that have jaws. Having jaws has an evolutionary advantage for this…

Q: Learning Task 2: Short Answer Examine the table showing the classification of four organisms. Then…

A: As per the guidelines first three questions are answered, please put different questions separately.

Q: A person enjoys his/her morning routine doing the following things: basking under the sun while…

A: Introduction A carcinogen is defined as a substance that is capable of causing cancer. It's vital to…

Q: 1. A primitive character is known as a. plesiomorphy b. apomorphy c. synapomorphy d. amorphy 2. What…

A: Q1. A primitive character is known as   a. plesiomorphy b. apomorphy c. synapomorphy  d. amorphy   Q…

Q: What would happen if: the enrichment method in the isolation of bacteriophage was omitted? the…

A: Introduction: Bacteriophages are viruses-infected bacteria that can be found in any environment…

Q: Which of the following is an INCORRECT combination of a hormone and its class of hormone? a…

A: Hormones can be categorised into three distinct groups according to their chemical composition The…

Q: 1st Season JUN 1 2nd Season 5 3rd Season tv

A: Development of different species is called evolution. It may occur due to many reasons such as…

Q: 1- "Man is the only real enemy we have. Remove Man from the scene, and the root cause of hunger and…

A: Ecology is the science that deals with the distribution of a number of living species influenced by…

Q: Hereditary hemochromatosis is an autosomal recessive genetic disorder that causes the body to absorb…

A: Mutations are alterations in the DNA sequence of an organism. Small changes, such as adding or…

Q: Which of the following statements about qPCR is true?   a. The Ct value is generally directly…

A: qCR or Quantitative PCR is the technique which allows the measurement of expression levels by…

Q: Early in the digestive process, a digestive enzyme found in saliva called ptyalin breaks down large…

A: Introduction:- Enzymes are proteins that aid in the speeding up or slowing down of the metabolic…

Q: Hypertrophy, hyperplasia and increases in extracellular material are forms of    A. growth  B.…

A: The answer is A  Growth Hyperplasia refers to the process where cells in an organ or tissue increase…

Q: What kind of membrane protein is found entirely outside the bilayer on either the extracellular or…

A: Introduction  Peripheral proteins are membrane proteins  which attach only temporarily to the…

Q: Q3. Using the mutated DNA parental template sequence, follow it through to the resulting polypeptide…

A: The gene or small portion of DNA undegoes transciption to form mRNA and then this mRNA undergoes…

Q: Describe the step by step method of preparing culture media in microbiology.

A: Culture media are the media or the substrate used to grow microorganisms.  There are different types…

Q: Why is it advantageous to have multiple steps during a signal transduction pathway? It allows fine…

A: The signal transduction pathway refers to the binding of intracellularly signaling molecules and…

Q: In rabbits, short hair (S) is dominant over lang hair (s). What genotype and phenotype ratios are…

A: The cross is between two heterozygous short haired rabbits. Here s is Dominant ove S. So, Ss × Ss…

Q: For each of the ff. scenario, state whether the gene is up- or down-regulated and briefly explain…

A: There are various regulatory elements present in the genome of the organisms that regulates the…

Q: There are several levels that describe biological organization. Tell me what these levels are and…

A: Cells are the basic building blocks of all creatures, albeit the quantity, shape, and types of cells…

Q: A diploid cell has 6 chromosomes.  How many chromosomes are present in this cell in Metaphase of…

A: Introduction There are two types of cell division are found in our body,  i.e. mitosis and meiosis.…

Q: 41. In acute prostatitis, an exam of the prostate may find the gland to be: A. Nodular B. Cool and…

A: Please follow step 2 for detailed explanation.

Q: what is the relation of dysmenorrhea to menstrual cycle? identify its causes prevention and cure

A: Introduction The reproductive system is involved in sexual reproduction. The male and female…

Q: Examine closely the dissected 5 different flowers for these characteristics based on:        -…

A: Characteristics of given specimens :-

Q: These describe sea daisies EXCEPT A. Common name is sea daisy B. Usual position in its natural…

A: Sea daisies make up an unusual group of deep-sea taxa belonging to the phylum Echinodermata, with…

Q: Explain how the disease effects the conduction of information and what class of neurons appears to…

A: Multiple sclerosis has no recognised aetiology. It's classified as an autoimmune illness since the…

Q: add deoxyz мохуч Q9. Recall that DNA an and RNA sequences are DNA sequence: GGUAVAVAVA 5'…

A: introduction Messenger RNA is a single-stranded RNA that is responsible for the synthesis of…

Q: 14. Female gonads that produce eggs and the female sex hormones. About 3 cm by 1cm in size 15.…

A: 14) Ovary : these are female primary sex organs and here oogenesis or process of formation of female…

Q: In this nanotechnology, nanoparticles are used to detect, quantify, and display nanoscale reactions…

A: Nanotechnology  It is defined as the science of nanoscale. It involves the utilization of matter on…

Q: Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA:…

A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…

Q: When a cell goes through Asexual reproduction, e.g. Mitosis, or fission, it creates: O Somatic Cells…

A: Asexual reproduction is a process where an organism creates a genetically identical copy of itself…

Q: What are the major elements of the eukaryotic cytoskeleton and what are their properties? Which of…

A: The eukaryotic cytoplasm contains a set of long thin fibres called the cytoskeleton. The cytoskelton…

Q: Seeds are produced through the process of______fertilization in order to create ___embryonic plants…

A: Answer :- 1. Double Fertilization 2. Embryo and endosperm.

Q: What kind of systems have been developed to detect CSCs? Describe by giving examples.

A: CSCs are a small subpopulation of self-renewing malignant and oncogenic cells that are responsible…

Q: Why do you think it is much more difficult to classify microbial species than plants or animals?

A: Introduction A microbe, or microorganism, is a microscopic organism. It may occur as a single-celled…

Q: Dendritic receptor Secretory vesicle Neurotransmitter Axon terminal C D 1. A 2. B 3. C 4. D B A

A: Neurons are fundamental units of brain and nervous system. It consists of axon, dendrites, soma and…

Q: Which of the following conditions will result to deactivation of a gene? a. histone methylation b.…

A: In this question we have to describe about regulation of genes . See full answer in step 2.

Q: “THE WAY TO A MAN’S HEART IS THROUGH HIS STOMACH:”  Explain the following quote with a unique…

A: What we eat and how much we eat are strongly tied to our nutrition. Getting enough nutrition and…

Q: Lipid chain ordering increases while motion also increases towards the end of the chain and middle…

A: the correct is false.

Q: Construct a diagram to explain FSH & LH and how their roles affect the female reproductive system

A: FSH ( Follicle stimulating hormone ),  LH ( Luteinising Hormone),  FSH and LH are the lipid hormones…

Q: What words below characterizes the amino acids that are found in an alpha-helical segment that spans…

A: The plasma membrane is present in the cell. It is responsible for covering the cell. It provides the…

Q: Write 3to5 sentence paragraph that reflects on your own ideas on why is there a need to classify the…

A: Introduction Taxonomic studies are not recently started but are done from ancient times by humans,…

Q: A perfect flower is one in which both ________     and ______________      are present.

A: Flower The flower is defined as the reproductive part of the plant which contains male and female…

Q: The somatic nervous system provides both excitatory and inhibitory signals t skeletal muscle. True…

A: Neurons are the structural and functional units of the nervous system. A neuron consists of the…

Q: 35) how epinephrine can have a depolarizing effect on one tissue and a hyperpolarizing effect on…

A: Hormones are chemical substances produced by our body's endocrine system, which releases the…

Viral Infections

Viruses are abundantly found, minute entities that have genetic material enclosed within a protein coat. The proteinaceous material enclosing the genetic material of the virus is called a capsid. The genetic material could be either DNA (deoxyribonucleic acid) or RNA (ribonucleic acid). A virus is too minute to be looked at with naked eyes and therefore visualized with the help of a microscope. They are acellular entities that require a host for processes, such as replication, transcription, translation and multiplication. Plants, animals, and bacteria act as host wherein the virus reproduce. Viruses cannot multiply outside the host's body and thus are considered nonliving outside the host body.