In hepatocytes, the enzyme glucokinase catalyzes the ATP-coupled phosphorylation of glucose. Glucokinase binds both ATP and glucose, forming a glucose-ATP-enzyme complex. The enzyme then transfers the phosphoryl group directly from ATP to glucose. Select the advantages of phosphoryl group transfer compared to hydrolysis and subsequent phosphorylation? ATP hydrolysis is thermodynamically unfavorable compared to group transfer. Glucokinase increases the transition state energy, favoring glucose phosphorylation. The process takes advantage of the high phosphoryl group transfer potential of ATP. Reaction intermediates do not need to be present in excess. Incorrect
Q: Explain the growing public health threats of emerging zoonotic infections and challenges in…
A: Zoonoses are diseases and infections that are naturally transmitted between humans and vertebrate…
Q: true/false: Pepsin cleavage of the peptide Ala-His-Gly-Trp-Val-Ile-Arg-Gly would yield the…
A: Pepsin is a proteolytic Enzyme that cleaves the peptide bonds with specificity. This can be used in…
Q: Phosphoenolpyruvate (PEP) is converted to pyruvate by the enzyme pyruvate kinase. The standard free…
A: The standard free energy change (∆Gº') is the amount of energy released in of biochemical reaction…
Q: What is the role of HCO3 in the activity of pancreatic enzymes? 2. What factors are needed in the…
A: DISCLAIMER FOR MULTIPART Since you have posted a question with multiple sub-parts, we will solve…
Q: Which of the following results are most likely to be observed in liver enzymes following initiation…
A: When subjected to a prolonged period of starvation, the level of glucose in the blood falls. This…
Q: Which of the following is an anomer of B-D-gulopyranose? O ОН I ОН т ОН I I ОН CH2OH II- Б ОН CH2OH…
A: Anomers are cyclic monosaccharides differing from each other in the configuration at carbon no -1…
Q: Electron transport chain. Complex 2
A: Electron transport is a succession of redox reactions, much like a relay race. It is a component of…
Q: 2. What is the terms used to describe what is happening to the members of the electron transport…
A: Electron transport chain is a chain of electron carriers present in the inner mitochondrial…
Q: Classify each metabolic reaction as an oxidation-reduction reaction, isomerization reaction, or…
A: Metabolism is the total of all chemical transformation that takes place in a living cell. One…
Q: Assume that you are conducting a chain-addition polymerization using 5.47 grams of monomer (MW=…
A: The number of moles is given by the ratio of the given mass in grams to the molar mass(MW) No. of…
Q: 2. Enzymes of the pyruvate dehydrogenase complex.
A: PDC is a multienzyme complex that catalyzes the conversion of pyruvate to acetyl-CoA via glycolysis.…
Q: Write a short description of the physical characteristics of acid & enzymatic hydrolysates. What…
A: Introduction: The principle of the benedict test is that when reducing sugars when heated in the…
Q: 3. Question from Lehninger...describe the common structural features and the differences for each of…
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. They are…
Q: Show below is a polypeptide comprised of 3 α-helices and 5 β-sheets joined by randomcoil.…
A: Tertiary structure of a protein is the 3-D structure of the polypeptide after it has undergone…
Q: What is the single definitive test for galactose? State the principle.
A: Galactose is a monosaccharide . it combines with glucose to form a disaccharide called lactose. It…
Q: Below is a Michaelis-Menten plot for a wild-type (WT) and mutant (V105A) enzyme isolated from the…
A: The best way to find out the Vmax and Km values are by plotting the Lineweaver Burk Plot (LB Plot).…
Q: Upon doing the experiment in Protein Denaturation, what could happen in the precipitation of heat…
A: Protein solubility is determined by the proportion & distribution of polar hydrophilic and…
Q: 1 which parts of amino acids are involved in tertiary structures ? 2 polar side chain can make…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: 14. Consider the molecules below and the answer questions that follow. CH-0-8-R₁ HC-0-C-R₂ 0-4-0-0₂…
A: Since you have posted multiple questions with multiple sub parts, we will provide the solution only…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…
Q: *What are the products of saponification (hydrolysis with NaOH as the catalyst) of 1-stearoyl-2,…
A: Triglycerides are fatty acid esters of glycerols. Fatty acids are carboxylic acids with a long…
Q: Elongation of fatty acids chains beyond 16 carbons takes place: on the membrane of the endoplasmic…
A: Acetyl CoA from glucose oxidation or other anaplerotic reactions is produced in mitochondria and…
Q: . What is the nucleotide sequence of the complementary strand of the DNA molecule:…
A: DNA is the genetic material in most organisms. During transcription RNA Polymerase synthesizes the…
Q: 2. Another bodily process is the urea cycle. However, a carbamoyl phosphate is necessary to begin…
A: Carbamoyl phosphate is synthesized with the help of enzyme carbamoyl phosphate synthetase requiring…
Q: Determine the direction that each of the reactions will progress. Assume that the reactants and…
A: Since conditions inside the cell are different than standard temperature and pressure, biochemists…
Q: Which of the following first messengers is hydrophobic and binds to a nuclear receptor protein…
A: The first messengers are extracellular biomolecules that bind to the cellular receptor and elicit a…
Q: Which of the following statements is correct regarding the structures below? CHO CHO но-н H H-OH ОН…
A: Carbohydrates can be classified into different types depending on their size into the following…
Q: Energy extraction and the complete oxidation of foodstuffs requires three stages. The energy…
A: Introduction Glycolysis is a process by which glucose molecules are converted into pyruvate and…
Q: Which of the following is NOT true of DNA Methylation. A. DNA methylation is typically…
A: DNA methylation is an epigenetic mechanism by which methyl groups are transferred to the DNA onto C5…
Q: How much ATP will be produced from the Beta-oxidation of lauric acid a C 12 saturated fatty acid?…
A: Lauric acid is a saturated fatty acid with 12 carbon atoms. The molecular formula of lauric acid is…
Q: Consider a membrane that has a very high content of phosphatidic acid on the inner leaflet of the…
A: Introduction Proteins are made up of amino acids. Protein plays various function in our body. Two…
Q: 1.How many chiral center does D-Eranose have? 2. How many stereoisomer are possible for D-Eranose.
A: Conformation is the different positions a molecule can twist into. Configuration is the arrangement…
Q: Metabolic Integration Q9.1: Glucose-6-phosphate is a key metabolic intermediate in four major…
A: Glucose-6-phosphate is the key metabolic intermediate where it is branched to four major metabolic…
Q: What are some applications for metalloproteins?
A: Metalloproteins are the types of proteins or enzymes that binds to a metal ion as a cofactor in…
Q: As Build's laboratory partner, help him determine the following: 1. maximum amount of the unknown…
A: Gel filtration chromatography is a type of chromatography in which proteins are separated based on…
Q: Which of the following amino acids has a negatively charged atom in its side chain at pH 7.2? a. V…
A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group linked to…
Q: Draw the structures of reactants and products in the transamination in which glutamate and pyruvate…
A: In a transamination reaction, an amino group is transferred from a donor substrate to an acceptor…
Q: 2. What is the terms used to describe what is happening to the members of the electron transport…
A: The electron transport system (ETC) is the series of redox reaction in which involved a series of…
Q: 5. Which of the following is true about myoglobin and/or hemoglobin? O (a) The iron in Hb is in the…
A: Both hemoglobin & myoglobin are globular proteins. Our red blood cells (RBCs) are composed of…
Q: Which reaction below in the glycolytic pathway has a highly unfavorable delta Gº¹ but a favorable…
A: Free energy changes: The Gibbs free energy is used to calculate the maximum amount of work that a…
Q: Both myoglobin and hemoglobin can adopt both T and R states. Both myoglobin and hemoglobin bind to…
A: Hemoglobin and Myoglobin: In terms of primary sequence, myoglobin and hemoglobin are only distantly…
Q: Compare and contrast the following. Use you own words and be sure to incorporate key biochemical…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: Substances like phencyclidine (PCP, or "angel dust") and ketamine ("Special K") are characterized…
A: INTRODUCTION : Phencyclidine : It is a synthetic drug, which is a compound being derived from…
Q: Question 5 An a-helix has the sequence: NH3-Ser-Glu-Gly-Asp-Trp-Gln-Leu-His-Val-Phe-Ala-Lys-Val-Glu-…
A: Alpha helix is a type of secondary structure of proteins. It is the rod-like structure formed when…
Q: Phosphorylases and phosphatases catalyze the same reaction, the removal of a phosphate group. True…
A: Enzymes are usually protein molecules which catalyzes several biochemical reactions by decreasing…
Q: For each pair of biomolecules, identify the type of reaction (oxidation‑reduction, hydrolysis,…
A: A dipeptide is a two amino acid linked via a peptide bond. The peptide bond is formed between the…
Q: Which reaction or reactions of glycolysis require NAD* as a reactant? Which reaction or reactions in…
A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…
Q: Fill up the table below. For inferences, indicate the identity of the macronutrient being tested in…
A: Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…
Q: Based on your molecular weight predictions from computational analysis of the DHFR fusion proteins…
A: Glutathione S-transferase (GST): Affinity tags are efficient methods that have been employed…
Q: Discuss the synthesis and utilization of ketone bodies.
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- In hepatocytes, the enzyme glucokinase catalyzes the ATP-coupled phosphorylation of glucose. Glucokinase binds both ATP and glucose, forming a glucose-ATP-enzyme complex. The enzyme then transfers the phosphoryl group directly from ATP to glucose. Select the advantages of phosphoryl group transfer compared to hydrolysis and subsequent phosphorylation? Glucokinase increases the transition state energy, favoring glucose phosphorylation. Reaction intermediates do not need to be present in excess. The process takes advantage of the high phosphoryl group transfer potential of ATP. ATP hydrolysis is thermodynamically unfavorable compared to group transfer.During glycolysis (under anaerobic conditions), for each glucose molecule broken down, how many ATP molecules are used and how many are made in total? A diagram summarizing the different reactions of glycolysis is given below. ATP ADP ATP ADP Glucose Glucose-6-phosphate Fructose-6-phosphate Fructose-1,6-bisphosphate Dihydroxyacetone phosphate 2 (Glyceraldehyde-3-phosphate) Glyceraldehyde- 3-phosphate 2 (1,3-Bisphosphoglycerate) 2 (3-Phosphoglycerate) 2 (2-Phosphoglycerate) 2 H₂O 2 (Phosphoenolpyruvate) 2 (Pyruvate) 2 NAD+ + 2Pi 2 NADH + 2H 2 ADP 2 ATP -2 ADP 2 ATP 2 ATP molecules are used and 2 ATP molecules are made 2 ATP molecules are used and 4 ATP molecules are made O 6 ATP molecules are used and no ATP molecules are made O 4 ATP molecules are used and 2 ATP molecules are made O No ATP molecules are used and 6 ATP molecules are madeSelect the correct statement regarding electrochemical gradients. Thermodynamically, electrochemical gradients will maintain their relative concentrations across both sides of the membrane. The cytoplasmic side of the cell membrane has a net positive charge relative to the extracellular side. Ions can freely pass through the cell membrane. Electrochemical gradients are sources of potential energy due to the differences in concentrationsand charge across both sides of the cell membrane. Select the correct statement(s) about transfer RNAs. Codon recognition occurs through specific base-pairing by the anticodon arm. Amino acids are linked to the T-loop. They are transcribed by RNA Polymerase III. There is strict matching requirements at the third position, else the tRNA cannot interact with the codon.
- Complete catabolism of one glucose molecule yields 38 ATP molecules. How many moles of ATP are produced by the complete catabolism of 10 moles of glucose?Several general characteristics of metabolic reactions or reaction pathways are listed. Classify them into the appropriate metabolic category. utilize ATP Anabolism convert NAD+ to NADH convert small compounds to larger compounds Answer Bank convert NADPH to NADP+ generally exergonic (spontaneous) Catabolism convert large compounds to smaller compoundsConsider ten glucose molecules that enter a cell. How many ATP can be generated by the complete catabolism of these into CO2 and H2O? If all ten are first incorporated into glycogen, liberated from glycogen, and then fully catabolized into CO2 and H2O, does the ATP tally increase, decrease or stay the same? Consider that 1 UTP = 1 ATP. Explain. Describe the processes which produce ATP and provide a balanced equation of glucose, CO2, H2O and O2
- You are studying energy production and metabolic activities of prostate cancer cells in the lab. You compare energy metabolism in these cancer cells with normal cells. Which of the following would you observe? Select all that apply Oxidative phosphorylation is reduced in cancer cells compared to normal cells Glycolysis is reduced in cancer cells compared to normal cells Oxidative phosphorylation is enhanced in cancer cells compared to normal cells Glycolysis is enhanced in cancer cells compared to normal cellsThe synthesis of ATP by oxidative phosphorylation, using the energy released by movement of protons across the membrane down their electrochemical gradient, is an example of which of the following processes?iodoacetate is an irreversible inhibitor of glyceraldehyde-3-phosphate dehydrogenase. which of the following is the expected outcome of the exposure of a cell to iodoacetate - Cellular resiration will stop if the cell solely depends on glucose as fuel - The rate of cellular respiration will increase - The reoxidation of coenzymes will noy be affected , but the efficiency of oxidative phosphorylation will be diminished - There will be no effect on cellular respiration as long as the cell has a large glucose reserve -The cell sill not be able to reoxidize the reduced coenzymes
- Provide a table for each question, listing all of the particular individual reactions that will generate ATP either through substrate level phosphorylation (SLP) or oxidative phosphorylation (OP). If the question calls for a shuttle system, please use both and calculate the net ATP for each. Question: glucose 6-phosphate to 2 succinyl CoA Sample table: 1,3 bisphosphoglycerate to 3-phosphoglycerate Specific reaction Number of ATP (- or +) 1, 3 bisphosphoglycerate to 3- 3 ATPS from OP via NADH + H in MA shuttle or phosphoglycerate 2 ATPS from OP via FADH2 in GP shuttle Net ATP 3 via MA or 2 via OPWhich of the following is the correct summary of phase II of glycolysis for each molecule of glucose? Glucose + ATP ⟶ Glyceraldehy-3-phosphate + ADP Glucose + 2 ATP ⟶ 2(Glyceraldehy-3-phosphate) + 2 ADP Glyceraldehyde-3-phosphate + NAD+ + ADP + Pi ⟶ 3-phosphoglycerate + NADH + H+ + ATP 2(3-phosphoglycerate) + 2ADP ⟶ 2 pyruvate + 2ATP 2(Glyceraldehyde-3-phosphate) + 2NAD+ + 2ADP + 2Pi ⟶ 2(3-phosphoglycerate) + 2NADH + 2H+ + 2ATPWe have discussed the aerobic metabolism of glucose extensively in this class. To capture and use the energy in glucose to make ATP, we must utilize 4 different sequential pathways/steps. Starting with one glucose molecule and eventually ending with CO2, H20 and ATP, list the 4 pathways/steps in order and tell me what molecules enter each pathway, and what the final products of each pathway are.