Fill in the RNA quantification table below: Sample A260 A280 A260 A280 Concentration (ng/μl) Untreated 1.8 1.2 type your answ type your answe Treated 1.6 0.64 type your answ type your answe Pure? choose your: choose your V
Q: Q1) a) Draw the absorbance spectra for the following DNA samples. a. Pure DNA without protein…
A: “Since you have posted multiple questions with multiple sub parts, we will provide the solution only…
Q: Consider the reaction below to answer the following question(s): + HBr A B Br с + D Br Enter the…
A: The kinetically controlled product is DOption 1 is correctExplanation:
Q: Which irreversible inhibitor is also known as a substrate analog? affinity label transition-state…
A: Irreversible inhibitors play a crucial role in biochemical research and drug development by…
Q: Genetics Question 16
A: The question is asking whether the number of chromosomes in the daughter cells produced at the end…
Q: 2. The diagram to the right shows the change in the structure of the C-terminal portion of each of…
A: Therefore, the final answer is: (a) Without the His146 residue, CPA-treated hemoglobin would have a…
Q: Explain the concept of protein folding and its importance in determining protein structure and…
A: The objective of this question is to understand the concept of protein folding and its significance…
Q: If non-disjunction occurs at meiosis 2 in a male, 2 of the 4 sperm formed in that meiosis will have…
A: Non-disjunction can happen in meiosis 1 or meiosis 2.Non-disjunction is said to have taken place in…
Q: 3. Acetylcholinesterase is a serine hydrolase enzyme im- portant in nerve signal transmission,…
A: Approach to solving the question: Enzyme reactions. Detailed explanation:1. here's an arrow-pushing…
Q: addition to L-lactate, which of the following molecules is (are) generated by fermentation of…
A: Fermentation is an anaerobic process that occurs in the absence of oxygen, leading to the conversion…
Q: drawing of electron pushing not the explaination I just need electron pushing arrow mechanism for…
A:
Q: Transcription factors are a specific type of nuclear proteins. How do transcription factors get…
A: Transcription factors are proteins that bind to the specific DNA sequences in or around the…
Q: what is balanced chemical equation for the oxidation of benzoin to benzil using sodium hypochlorite
A: ### Reactants1. **Benzoin**: This is an organic compound with two aromatic rings bonded together…
Q: 3. What is something noteworthy about the following sugar modifications in terms of their…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: Genetics Question 7
A: The objective of the question is to identify the correct event that occurs during the prophase of…
Q: a)Dr. Thisisaneasyexam decides to amplify a gene from a plasmid using PCR. She starts out with 6.6 x…
A: Sure, let me provide a more detailed explanation for the calculations.a) Calculating the number of…
Q: A useful method for studying membrane proteins in place in the membrane is a. nuclear magnetic…
A: Membrane proteins are common proteins that are the part of biological membranes.
Q: Binding of a ligand to protein X affects the binding properties of another site on X. This is an…
A: An enzyme is defined as a biological catalyst or simply a molecule that is typically always a…
Q: (a) In the space below draw a free energy landscape diagram for the conversion of substrate (S) into…
A: Transition state theory states that as a substrate is converted into a product, a high energy state…
Q: In N-linked glycoproteins, the sugar molecule is usually bound to a Asp b Ser c Asn d Thr
A: Glycoproteins are conjugated biomolecules where a protein is covalently bound to a carbohydrate…
Q: What are the donor atoms involved in Aspartame-Cu(II) binding? A) Nitrogen atom of alpha amine group…
A: Aspartame contains two amino acid residues, aspartic acid and phenylalanine, linked by a peptide…
Q: An π helix can be described as a 4.4 helix. Explain 16 what this designation means. Given the pitch…
A: ●A π helix is a type of secondary structure found in proteins.The amino acids in a standard π-helix…
Q: During the early stages of an enzyme purification protocol, when cells have been lysed but cytosolic…
A: If a reaction velocity v/s substrate concentration curve shifts to the right, then the curve becomes…
Q: Genetics Q4
A: The objective of the question is to find the sequence of the opposite strand of a given DNA strand.…
Q: Molecule A held promise as a treatment for rheumatoid arthritis except that it remained in the body…
A: Many factors determine the duration of time a drug stays in the body. The drug being hydrophobic…
Q: What makes photorespiration disadvantageous regarding crop yields?
A: "Since you have posted multiple questions, we will provide the solution only to the first question…
Q: 6. Discuss the potential contributions of ionic interaction, hydrogen bonds, hydrophobic…
A: Aspartic acid (Asp) contributes to ionic and hydrogen bonds, while hydrophobic and Van der Waals…
Q: 4. In the reaction in which glyceraldehyde 3-phosphate is oxidized to 3-phosphoglycerate, which…
A: The process of oxidation and reduction in a reaction is collectively called Redox reaction. During a…
Q: Extension Questions Which of the following sequences correctly represents the flow of electrons…
A: Extension questions •The correct sequence representing the flow of electrons during photosynthesis…
Q: 1. Draw the Fisher projection of D-glucose, and from Fisher to Haworth projection of ẞ-D-glucose.…
A: The configurations of the D-glucose are: R , S , R , RIn β−D−glucose C1 -OH is present on the up…
Q: 11. A polypeptide is making a short a-helix. A typical residue in an a-helix is involved in two…
A: In an alpha helix, each amino acid residue forms hydrogen bonds with the amino acid located three…
Q: How does the predicted molecular weight of AlaE (16949.07) compare with the molecular weight of the…
A: SCAM (Substituted Cysteine Accessibility Method) is an analytical technique which is used to study…
Q: Genetics Q5
A: The term 'semiconservative DNA replication' refers to the process by which DNA replicates itself.…
Q: Choose all of the completely correct statements describing peptide X below: 00. 00 HO. O €0 NH3 O:…
A: Proteases are the protein digesting enzymes which cleave peptide bonds. There are some proteases…
Q: You obtained the following raw data when setting up a Biuret standard curve: Absorbancy BSA (mg/ml)…
A: Proteins are large biomolecules made up of amino acid residues linked via a peptide bond. Amino…
Q: Genetics Q3
A: The objective of this question is to identify the recombinant offspring and calculate the…
Q: Describe the amino acid composition in terms of the general characteristics and comment on what the…
A: Proteins are made up of around 20 standard and a few non-standard amino acids. Depending on the…
Q: With the ninhydrin method, it was determined that an acyclic decapeptide consists of the following…
A: Elastase cleaves the peptide bonds formed by small hydrophobic amino acids, towards the C-terminal…
Q: You have a protein with MW 48kDa. How many grams of protein are in a 200 mL sample at 50 μM?
A: To calculate the amount of protein in grams in a 200 mL sample with a concentration of 50 μM, follow…
Q: Modify the structure to show the MAJOR product that would be formed in the following reaction. HNO3,…
A: The process is electrophilic substitution.The Modified structure of the prouct is shown in the…
Q: a. Write the structure of a-D-fructose.
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: 7. What is the driving force that promotes secondary structure formation of alpha helices and beta…
A: Two types of secondary structures are abundant in protein: alpha helix and beta sheets.The alpha…
Q: Genetics Question 15
A: Homologous pairs are pairs of chromosomes that possess genes for the same traits at corresponding…
Q: Identify the product of the given reaction. IV I II III heat ? = III IV
A: Option (d) III is correct See solution in image Explanation:
Q: Is increasing the P; concentration a reasonable way to couple ATP hydrolysis and glucose…
A: When considering the phosphorylation of glucose to form glucose 6-phosphate, we have:The standard…
Q: 1. Rank the following amines from lowest to highest boiling point. Explain your reasoning. CH3…
A: Answer 1correct order is B< A< CExplanation:Step 1: Step 2: Step 3: Step 4:
Q: If the membrane potential of a neuron drops to -55mV and sodium ions start to flow from outside to…
A: Concentration of ion gradients across a membrane and selective movements of ions along gradient…
Q: Part D Tubes 1 weight w/o water graph 25 3 4 5 61718 9 1.065g 1.073g 1.072 1.082 1.090g|1.105 g.…
A: Pipetting is a fundamental technique in biochemistry used for the accurate and precise transfer of…
Q: ACTIVITY 10.7.1 Complete the table below for the gluconeogenesis with their corresponding precursor…
A: The metabolic process in the liver called "gluconeogenesis" creates glucose from precursors that are…
Q: (c) The tube and cylinder diagram to the right illus- trates schematically the potassium channel…
A: answers are given below.Explanation:c) the positioning of Tyr62 and Thr74 on the Alpha helix is…
Q: Throughout the electron transport chain many reactions occur. What happens to NADH eventually? ONADH…
A: In terms of hydrogen atom transfer , Oxidation is defined as the reaction in which a substance or a…
Trending now
This is a popular solution!
Step by step
Solved in 4 steps with 8 images
- Human immunodeficiency virus (HIV), the causative agent of acquired immune deficiency syndrome (AIDS) infects T-helper cells that have the CD4 receptor on their surface: gp120 RNA- Core with protein coat Envelope (a) Structure of HIV Copyright © 2001 Benjamin Cummings, an imprint of Addison Wesley Longman, Inc. Edit View Insert Format Tools Table 12pt Paragraph -Reverse transcriptase enzyme B -Capsomeres of protein coat I U Αν 2 T cell A. As shown in the above diagram, HIV attaches to a susceptible cell by a binding interaction between the gp120 protein on the virus protein and the CD4 and CXCR4 receptors on the surface of the T-helper cell. What will be the next event in the virus life cycle? B. One mechanism for transmission of HIV is direct contact during sexual activity. What is the other common mechanism of transmission? over DNA (b) HIV infecting a T cell with CD4 receptors, and CXCR4 coreceptors which are distributed over the surface of the cell T² v -CD4 receptor -CXCR4…Below is the DNA sequence of a patient with overlapping genes (a single mRNA has multiple initiation points for translation) for two different proteins (DADαs and AMA): 5’- GTCCCAACCATGCCCACCGATCTTCCGCCTGCTTCTGAAGATGCGGGCCCAGGGAAATCTCTAACG-3’ 1. Indicate the DNA sequence coding for RNA. 2. Indicate the amino acid sequence of each of them.BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple
- Answer the following 2 questions based on the figure below. The figure represents a ERNA that recognizes and binds a particular amino acid. of Second letter A UUUphe UAU UACTy UAA Stop UGA Stop A UAG Stop UGG Trp C UGU UccJCy UCU UUCJ UUA 1. UUG Leu UCC Ser UCA UcO CUU CUC Leu CGU CAUTHis CU CAC. CAA CAG CGC Pro Arg CUA CCA CGA CG, CUG AUU AGU Ser AGC. ACU AUC File A AUA ACC Thr ACA AAC AAA Lys AGA Arg AUG Met ACG AAG GAU GUU GUC GUA GUG GCU GCC GAC. GAA GAG Gu Asp GGU] GGC Gly val Ala GCA GCG) GGA GGG) G 1. Which codon (from 5-3) on the MRNA strand codes for this amino acid? (write your answer in the first box) 2. Which amino acid this RNA binds? (write your answer in the second box) First letter Third letterDesign 6 bp primers to amplify the region of this sequence that is highlighted in yellow. attatatttt atattatata ctctgggctc agagcagccc 40 41 atattatata tatatatttt aaaatattat aaatttattt 80 81 cagtcacgcg tcctgatgac attatatttt ataatttttt 120 121 ttttattttt attatatttt aaaatattat aaatttattt 160 161 aaaatattat tatatattta aaatttattt attataaaat 200 201 aaaatattat ttttattttt gagatcagga cggctgcatg 240 Forward primer Reverse primerSickle cell hemoglobin DNA CA CG TAGACTGAGGACA C Sickle cell hemoglobin MRNA Sickle cell hemoglobin AA sequence ValoHis.lku thro proo Gily 4. What type of mutation is this? Please explain why.
- What would happen if you changed the anticodon in the Tryptophan tRNA from ACC to AAC? First letter U C A G U UUU Phe UUC Phe UUA Leu UUG Leu CỰU Leu CUC Leu CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met GUU Val GUC Val GUA Val GUG Val Second letter C A UCU Ser UCC Ser UCA Ser UCG Ser CCU Pro CCC Pro CCA Pro CCG Pro ACU Thr ACC Thr ACA Thr ACG Thr GCU Ala GCC Ala GCA Ala GCG Ala UAU Tyr UAC Tyr UAA Stop UAG Stop CAU His CAC His CAA Gln CAG Gln AAU Asn AAC Asn AAA Lys AAG Lys GAU Asp GAC Asp GAA Glu GAG Glu G UGU Cys UGC Cys UGA Stop UGG Trp CGU Arg CGC Arg CGA Arg CGG Arg AGU Ser AGC Ser AGA Arg AGG Arg GGU Gly GGC Gly GGA Gly GGG Gly O Tryptophan would be incorporated into peptides where leucine normally goes Tryptophan would be incorporated into peptides where it normally goes ○ Leucine would be incorporated into peptides where Tryptophan normally goes O Histidine would be incorporated into peptides where Leucine normally goes U C A G U C A G U C A G U C A G Third letter015347/quizzes/5825797/take 21. The processing events that must occur on the MRNA after it is transcribed, but before it is released into the nucleus include (select all that apply) Primary RNA transcript Exon 1 Intron Exon 2 Intron Exon 3 RNA processing Spliced RNA Exon 1 Exon 2 Exon 3 AAAAAAA 5' cap Poly-A tail 3' untranslated region 5' untranslated region O folding into its functional shape O splicing out exons O adding a poly-A tail O removal of non-coding sections O capping the 5' end hp5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino acid sequence using the 3 letter code. Write the answer in a all capital letters. Leave a space between the amino acids. Do not write 5' and 3'.
- 1. You are investigating a protein that has the amino acid sequence N ... Ala – Thr - Asn – Trp – Lys - Arg - Gly – Phe – Thr ... C within its primary structure. You found that several of the mutations affecting this protein produced shortened protein molecules that terminated within this region. In one of the mutants, the Asn became the terminal (last) amino acid. (a) What DNA single-base changes(s) would cause the protein to terminate at the Asn residue? (b) What other potential sites do you see in the DNA sequence encoding this protein where mutation of a single base pair would cause premature termination of translation? >Given the sequence below, (A) What is the transcript (MRNA) sequence? (B) What is the amino acid sequence of the translated peptide? Rather than using abbreviations, write out the entire name of each of the amino acids in your peptide, so you do not risk using the wrong abbreviation and, therefore, providing the wrong sequence. 5' - ATG CTT GTA ATA CCG TGA - 3'Kindly help, I don't understand this topic :(( In each of the following DNA sequences, write the contesponding mRNA transcript right beside the item we the item and use the genetic code to determine the resulting amino acid sequence. You may proceed even without the start codon 1. TTTTACCATCCCACAATTTA 2 ACTACTTTCAGAGCTATATTCAG 3. CATTACGGAGCCTGATGCACTTAC 4. TACGCCGCAACTCCGTATGGO 5. Garg-CTACAGCCCTAGCATTTACCCG