D. How many times would you expect to find a specific 20 base pair sequence in the human genome?
Q: What are the possivble oxidation product of catalase using H2O2 as the substrate? Explain in 1-3…
A: Catalase is an enzyme found in living organisms, including humans, that plays a crucial role in…
Q: 27.Arginine is the most basic of the 20 amino acids because its side chain is most cells conditions.…
A: Amino acids are the monomers of proteins. These are the molecules that contain both amino and…
Q: Given the melting profile of a membrane bilayer consisting of (see attached diagrams) where R =…
A: The graph here has degree of fluidity as Y-axis and temperature as X-axis. The curve will shift to…
Q: Give typed full explanation not a single word hand written otherwise leave it
A: The basic metabolic route known as the tricarboxylic acid (TCA) cycle, sometimes referred to as the…
Q: how do low levels of NADH regulate the CAC?
A: CAC, also known as the Krebs cycle act as a central metabolic pathway which generates energy in the…
Q: Using proper convention, provide the amino acid sequence for the following protein.…
A: A basic characteristic of proteins is their amino acid composition, which is essential to defining…
Q: Account for the difference in action of maltose, lactose, sucrose in the benedict's test.
A: Benedicts Test makes use of the reducing property of carbohydrates and thus confirms the presence of…
Q: ou are given a drink that has been sweetened with either maltose or sucrose. Using the following…
A: The Somogyi-Nelson test is a quantitative test used for the estimation of reducing sugar in the…
Q: Which of the following glycolytic enzymes is NOT subject to regulation a) Hexokinase b) PFK-1 c)…
A: Glycolysis is a metabolic pathway occurring in the cytoplasm of cells that breaks down glucose into…
Q: What is the effect of insulin on the committed step of glycolysis in the liver? Describe the…
A: In the liver, insulin can affect the committed step of glycolysis through its impact on the activity…
Q: Complete the following description of the mechanism of the pyruvate dehydrogenase complex by using…
A: Glycolysis of one glucose molecule produces two pyruvate molecules. These pyruvate molecules are…
Q: The researchers did not study the effects of NADH, ADP and ATP on the enzyme. Given what you know of…
A: Enzyme are proteins molecules that catalyse the biochemical reactions. They are very crucial for…
Q: 7 a-d. i. ii. Draw the Hydrogen bonds between the base pairs and label the atoms that participate in…
A: There are 2 conventional base pairs in DNA. They are; Between Adenine and Thymine Between Guanine…
Q: 5.26) In transamination reactions, a-ketoglutarate is converted to glutamic acid. The other…
A: Amino acids are the building blocks of proteins, and they can be used for energy production when the…
Q: What is the classification of the side chain R group in the amino acid shown here? H3N-CH-C-0 ī CH₂…
A: The proteins are constituted of twenty naturally occurring amino acids. The amino acids can be…
Q: The response the AI gave me contains several errors. These errors include incorrect facts and…
A: Polyglutamic acid is a polymer of glutamic acid units. There are two types of polyglutamic acid:…
Q: Give the product of this reaction sequence: NH3* Bg-CH3 Bg SH Adenosyl-S (cobalamin) H₂C-NH OH A…
A: The reaction sequence given in question is actually part of an activated methyl cyclic metabolic…
Q: The following compounds have high phosphoryl group-transfer potential except— phosphoenolpyruvate.…
A: Compounds with 'High phosphoryl group-transfer potential' are often used to drive biochemical…
Q: A scientist successfully analyzed a new micro-organism. Because this micro-organism contains…
A: Since you have posted multiple questions, we willprovide the solution only to the first question as…
Q: 14.23) All forms of life can have their cells invaded by viruses. When viruses take over plant or…
A: Viruses are small infectious agents that can only replicate inside living host cells. They have a…
Q: What ion or ions are required for PYC activity? What ion or ions inhibit PYC activity? Remember,…
A: The reaction catalyzed by pyruvate carboxylase (PYC) is given below. Pyruvate + HCO3- + ATP →Mg2+ ,…
Q: Draw the schematic diagram of the protein purification through hydrophobic column chromatography and…
A: Hydrophobic Column Chromatography or Hydrophobic Interaction Chromatography (HIC) is a technique…
Q: 1. What general factors contribute to the high phosphoryl-transfer potential of ATP?
A: ATP (adenosine triphosphate) is called the "energy currency" of the cell because it transfers and…
Q: volume of the quasi-steady-state culture was V0= 500 L, and the nutrient solution containing glucose…
A: For achieving the optimal growth of the microorganisms or cells in culture the quasi-steady state or…
Q: A protein contains 342 amino acid residues. Assuming that the whole protein is in alpha- helical…
A: Alpha-helix is one of the most prominent secondary structures in proteins. In an alpha-helix, length…
Q: The first step of gluconeogenesis involves the carboxylation of pyruvate and has a large negative…
A: Carboxylation is the process of adding a carboxylate (COO-) group into a molecule. Upon…
Q: Q10 What would happen if DNA polymerase III encountered the nucleoside triphosphate on the right?…
A: Nucleic acids are biomolecules that are essential for all life forms. They are polymers of…
Q: 14. In competitive inhibition, an inhibitor— binds reversibly at the active site. binds to both…
A: Enzymes are biological catalysts that increase the rate of chemical reactions in living organisms…
Q: Biological Equilibrium Processes One example of a biological equilibrium process in nature is the…
A: Every reversible reaction has an equilibrium. Consider the reversible reaction given below. A ⇌ B…
Q: Name the purine bases found in nucleic acids? Explain in 1-3 sentences
A: Nucleic acids are complex macromolecules that play a central role in the storage, transmission, and…
Q: 7. What does nature show about building organisms from the bottom up?
A: Understanding how organisms work is inspired by nature. Nature builds organisms bottom-up, from…
Q: A PCR reaction was performed to amplify the XULA4 gene, which is bp 524-6,480 on a plasmid that is…
A: A plasmid is a circular DNA. Restriction enzymes cut DNA at specific sites called the restriction…
Q: 15.4) a) Name the products of the dephosphorylation of ATP reaction shown below. NOTE: You do not…
A: Dephosphorylation of ATP (adenosine triphosphate) is the process of removing a phosphate group from…
Q: Which of the following, if any, cannot be genetically encoded in DNA? a)mRNA b)tRNA c)rRNA (RNA…
A: DNA is the genetic material in most living organisms. The process of transcription that is catalyzed…
Q: 5.14) The metabolic strategy of oxidative phosphorylation is to convert the chemical potential…
A: Oxidative phosphorylation is the metabolic pathway by which cells generate energy in the form of ATP…
Q: Literature review for confirming the type of inhibitor exerted by AZT on the HIV reverse…
A: HIV is the Human Immunodeficiency Virus, which damages the human immune system and causes AIDS or…
Q: Why dies chewing a piece of bread develop a sweet taste in a while? Explain in 1-3 sentences
A: Bread is a source of carbohydrate. Bread is composed of complex carbohydrate like starch.Our mouth…
Q: Write the three-letter abbreviations for the amino acid residues, in order from N-terminus to…
A: Here we are given the 3'→5' directing strand of the DNA . This strand is the template strand. During…
Q: Chemical potential energy stored in the reduced coenzyme, NADH or FADH2 is converted to chemical…
A: A catabolic reaction refers to a type of metabolic process in which complex molecules are broken…
Q: Role of the triacyl glycerol cycle. Summarize the cycle referring to the figure. What role does the…
A: Triacyclglycerol is a glycerol molecule esterified at its three hydroxyl groups by 3 fatty acid…
Q: Of the following pairs of metabolites and enzymes, which would be an example of product inhibition?…
A: The type of inhibition in which the product of the reaction catalyzed by the enzyme itself inhibits…
Q: Which effect is a response to glucagon secretion? OA. Inhibition of skeletal muscle VLDL transport…
A: Glucagon is a peptide hormone. It is secreted by the pancreatic cells in response to low levels of…
Q: The basic unit of life is the cell, and now in a modern laboratory even mammalian cells can be…
A: Laboratory research and biotechnology require mammalian cell culture medium design. Several factors…
Q: Which of the following are more likely to promote the activity of gluconeogenesis rather than…
A: Gluconeogenesis is the process by which glucose is synthesized from non-carbohydrate precursors,…
Q: 7. An enzyme-catalyzed reaction proceeds by the mechanism below: E+S1→ES --2E+P E+A 3 EA EA+S4EAS -5…
A: The Rapid Equilibrium Assumption (REA) refers to the assumption that the formation of the…
Q: Protein Z in the figure below depicts the activity of which bacterial Nucleoid Associated Protein…
A: The genetic material in bacteria is DNA. To fit the bacterial chromosome inside the tiny bacterial…
Q: Lab, you will need to design your own experiment that detects the nucleic acids from the given list…
A: The NP refers to nucleoprotein of the virus. It can be part of the capsid that encapsulates the RNA…
Q: >1HPL_1|Chains A, B|LIPASE|Equus caballus (9796)…
A: Lipases are enzymes that catalyse the hydrolysis of fats. Lipase use water to break the ester bond…
Q: In the stomach, what is the expected protonation state of the side chain of amino acid D?…
A: Aspartic acid abbreviated as Asp or D is a non-essential amino acid that serves as building block of…
Q: Which is most likely to be tightly bound by an enzyme? a)Analog of the starting material (SM),…
A: Enzymes are biocatalysts that speed up biochemical reactions. The substrate binds to the enzyme's…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Part 3. Restriction Enzymes 1) Consider the sequence of DNA given below and answer the following questions 5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’ a) You cut the sequence of DNA shown above using BamHI (see table 19.1 from the text). How many fragments of DNA would you expect to result from this restriction digest? b) If you cut the sequence of DNA shown above using BclI (recognition sequence = 5’ TGATCA 3’, enzyme cuts after the first T) instead of BamHI how many fragments do you expect? 2) For each given sequence/restriction enzyme pair, determine how many pieces of DNA would result form the digest and indicate whether those pieces would have blunt or sticky ends. NOTE: in the given recognition sites, the dash represents where the cut is made. a) HpaI, recognizes 5’ GTT – AAC 3’ 5’ GGATGTTAACAATCTCTACGGGTTAACACCCTTGGGTTAACATCCGCGG 3’ 3’ CCTACAATTGTTAGAGATGCCCAATTGTGGGAACCCAATTGTAGGCGCC 5’ Number of fragments of DNA:…Section A: Linear DNA Common restriction enzymes include: EcoRI, Hindll and BamHl and their sequences are as follows, with the cut site indicated by the arrow (figure 1). Please note that A DNA refers to linear DNA in this tutorial. HindIII 5'..A AGCT.3' 3'....TTCGA A...5' EcoRI 5'..G AATTC...3 BamHI 5'....G GATCC...3' 3' .....CTTAA G..5 3'...CCTAG G...5' Figure 1: Restriction sites of restriction enzymes. When DNA is cut with restriction enzymes, the fragments can be seen on an agarose gel (see figure 2). Base Pairs 21220 25.000 10.000 8,000 6.000 5,000 6557 4361 1641 7233 4,000 3,000 2,500 7421 2.000 5804 E643 1,500 1.000 4878 750 -564 S00 E 3530 125 250 A cut with EcORI A cut with Hindil A cut with BamHI A C D Figure 2: DNA fragments on an agarose gel showing the following: A) a molecular ladder, B) DNA cut with EcoB, C) DNA cut with Hipd, D) DNA cut with Bam The above figure shows the size of each of the fragments/bands produced when A DNA is cut with each of these restriction…Part 2. PCR 1) In one color, write out the forward primer (5’ GATAC 3’) in the correct position relative to the given template DNA sequence. In a second color, act as the polymerase and fill in the rest of the new strand of DNA Primer/New Strand Template DNA: 3’ TAGCTATGCGGACCTCATGCATTAGAGTAG 5’ Part 3. Restriction Enzymes 1) Consider the sequence of DNA given below and answer the following questions 5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’ a) You cut the sequence of DNA shown above using BamHI (see table 19.1 from the text). How many fragments of DNA would you expect to result from this restriction digest? b) If you cut the sequence of DNA shown above using BclI (recognition sequence = 5’ TGATCA 3’, enzyme cuts after the first T) instead of BamHI how many fragments do you expect? 2) For each given sequence/restriction enzyme pair, determine how many pieces of DNA would result form the digest and…
- 3. A linear DNA fragment is cleaved with one, two or three restriction enzymes to yield fragments as follows: Enzyme(s) Fragments (kb) HindIII 2.5, 5.0 Smal 2.0, 5.5 HindIII + Smal 2.5, 3.0, 2.0 HindIII+ Smal+ EcoRI 1.5, 2.0, 2.5 Draw the restriction map of the original DNA fragment, indicating the positions of all restriction sites.Part A Which of the following statements concerning restriction enzymes is true? Select all that apply. ►View Available Hint(s) ☐ Restriction enzymes specifically target and cut RNA in a sequence-specific manner. Restriction enzymes occur naturally in viruses as a defense mechanism against bacteria. Some restriction enzymes generate overhangs in the target DNA sequence upon incubation. During a cloning experiment, the vector and target DNA should be cut with different restriction enzymes to ensure that sticky ends are generated. Submityou carry out DNA editing using CRISPR whter the editing template DNA has strands labeled with heavy nitrogen 15N. The experiment is carried out in presence ofnormal light isoptope 14 N. The expected distribution of the isotope in the strands in the edited region of the target DNA would be: 1. only one strand is labeled iwth 14 N and the other with 15 N 2. both srrands are labeled with 15 N 3. both strands are labeled with 14 N
- Q.1. Imagine you are working for a research laboratory and you are asked to help withthe following:a. Cut the following segment of DNA using E. Co R I. Write the sequence offragments clearly and separately. ATTTACGAATTCTTCCAAGAATTCCTAAATGCTTAAGAAGGTTCTTAAGG b. Show sticky ends? How restriction endonuclease are different from the restriction-modification system?23. Important elements of a directed evolution experiment (“evolution in a test tube”) for an ATP-binding aptamer include: MARK ALL THAT APPLY. Group of answer choices Mutagenic PCR DpnI restriction enzyme Randomized DNA pool ATP affinity columnEcoRI recognizes G A-A-T-T-C sequence and cleave/ cut between G and A. How will the DNA fragments look like if EcoRI is used for the DNA below? How many fragments are produced? 5- AAAGATTTGAATTTCGAATTCAATTTAAGAATTCCCTTAGAATTTCC -¹3
- Im designing a restriction cloning experiment. My professor said that plasmid and insert DNA work best in a 1:1 ratio. If my reaction does not work the first time I perform it, how would I ensure that the cause was the difference in concentration of reagents and how would I fix it so that the I have the correct concentration? If a restriction cloning experiment does not work, how could I be certain that it was due to an incorrect ratio of plasmid:insert and how can i fix this?Genetic Engineering Process (GEP) # 1: (What kind of process?) Picture A (Sequence #_ DNA introduced into bacterial cells Picture B (Sequence #, DNA ligase added, seals overhangs TTAA AATT AAT AATT TAA TTA TAA PATT PATT AATT recombinant DNA molecules Picture C (Sequence #. donor DNA vector vector and donor DNA digested (cleaved) with restriction enzyme AATT AATT 1477 AATT TTAA overhangs TTAA 1477 Picture D (Sequence #. AATT mixing recombinant DNA molecules replicate and cells divide25. The restriction enzymes Kpnl and Acc651 recognize and cleave the same 6-bp sequence. You have a plasmid and a linear DNA strand that both contain a Kpnl and Acc651 sequence in the same orientation as shown below. You digest both DNA pieces with both enzymes and then attempt to ligate the sticky ends, followed by treatment with DNA ligase. What will happen? 5' GGTACC3' 5' GGTACC3' 3 CCATGGS 3 CCATGGS Kpnl Aсс651 A) You will produce sticky ends but the two types of ends will not ligate. Instead, you may produce a small amount of religated plasmid where the digested plasmid sequence re-inserts. B) You will produce a recombinant plasmid in which the linear DNA strand is ligated in between the two sites, suitable for cloning. C) You will produce blunt ends that will not ligate because the two restriction enzymes will both operate on both of the sites. D) All the DNA will be completely digested as if you had applied a general DNAse enzyme.