(d) Write down the sequences of the templates that would give the tetranucleotides shown in l and II. In each case, label the 5' and 3' ends and indicate which template base is used first. (e) What difference would it make to bidirectional DNA replication if both modes of chain extension were equally favourable? I II
Q: A circular molecule of DNA contains 1 million base pairs. If the rate of DNA synthesis at a…
A: in prokaryotes, the genomic DNA is in a circular format and adopt the theta replication model,…
Q: 5'- -3'
A: The mechanism by which a double-stranded DNA molecule is replicated to create two equivalent DNA…
Q: a) If you isolated DNA from the ear and the tail of the same mouse, would you expect the DNA,…
A: The extraction of deoxyribonucleic acid (DNA) from diverse sources is known as deoxyribonucleic acid…
Q: Draw a molecule of DNA undergoing theta replication. On your drawing, identify (a) origin of…
A: Deoxyribonucleic acid (DNA) is a double-stranded molecule, which consists of two strands of…
Q: Assume that a certain bacterial chromosome has one origin of replication. Under some conditions of…
A: The replication in bacteria will be bidirectional hence initially two replication fork per Double…
Q: In the diagram below, the arrow indicates the direction of movement of a replication fork.…
A: DNA (deoxyribonucleic acid) is a nucleic acid. They are double helical structure that wind around…
Q: If deoxyribonucleotides that lack the 3’-OH groups are added during the replication process, what do…
A: Dna replication is a process in which a copy of the dna is formed from the parental strand.the dna…
Q: Suppose that replication is initiated in a medium containing moderately radioactive tritiated…
A: Replication is the process of synthesis of DNA strands from the original strands where…
Q: In an experiment, you grow bacterial cells for several generations in the presence of a light…
A: Introduction The process by which the genome's DNA is copied in cells is known as DNA replication.…
Q: At a specific area of a chromosome, the sequence of nucleotides below is present where the chain…
A: Replication is the process of making of daughter DNA from the parental DNA.
Q: Using 14N isotope medium for DNA replication instead of 15N, what would be observed ifDNA…
A: DNA replication is the process of copying the DNA molecule using parental DNA molecule as template.…
Q: is DNA replication called semiconservative? A. Both daughter strands are entirely new B. Each…
A: Replication of DNA is very important for the transmission of chromosomal DNA from one generation to…
Q: If the sequence 5′-AACGC-3′ were damaged by reactive oxygen species, what would be the most…
A: Mutation is the process by which the sequence of DNA is altered and can result in deleterious…
Q: Suppose that 28% of the nucleotides in a DNA molecule are deoxythymidine 5′- monophosphate, and that…
A: DNA is a double stranded helical polynucleotide. It usually consists of two helices, sequences of…
Q: Assume that the sequence of bases shown below is presenton onenucleotide chain of a DNA duplex and…
A: DNA ( deoxyribonucleic acid) is the genetic material that the organism inherits from the parental…
Q: If the gene for primase were mutated so that no functional primase was produced, what would be the…
A: The process of DNA replication is essential during the cell division cycle in both the eukaryotic as…
Q: Consider the following segment of DNA, which is part ofa much longer molecule constituting a…
A: Deoxyribonucleic acid, or DNA, could be a molecule that contains the directions AN organism must…
Q: Why are Okazaki fragments formed? A. Okazaki fragments are the result of discontinuous replication…
A: Answer : Option "E" is correct - Okazaki fragments are formed when the 5'-3' complementary strand…
Q: 2a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that…
A: AT GC base pairing: In double stranded DNA, the guanine (G) base on one strand can form three…
Q: A bacterium synthesizes DNA at each replication fork at a rate of 1000 nucleotides per second. If…
A: Nucleotide is a molecule that consists of nucleoside and phosphate group. These are the building…
Q: What is true of this figure? (can be multiple answers) a. the replication fork is asymmetrical b.…
A: DNA is the genetic material of an organism. DNA replication is a process in which two DNA molecules…
Q: Describe in order, the four repeating steps that repeat over and over on the discontinuous lagging…
A: Replication: it is the process by which new DNA is produced from the old DNA by semi-conservative…
Q: Draw a molecule of DNA undergoing eukaryotic linear replication. On your drawing, identify (a)…
A: Deoxyribonucleic acid (DNA) is a double-stranded molecule, which consists of two strands of…
Q: The chromosome of E. coli contains 4.6 million bp. How long will it take to replicate its DNA?…
A: Chromosomes are a compact form of DNA wrapped around some proteins and are generally present in a…
Q: DNA that has been labeled with 15N is used as the template for replication. Replication is carried…
A: Watson and Crick proposed that the double-strand DNA (dsDNA) replication is a semiconservative…
Q: During DNA replication, the function of RNA primers is to Group of answer choices serve as a…
A: DNA replication is the process by which two copies of DNA is produced from a parent DNA molecule. It…
Q: Given the diagram of the replication fork below, indicate the chemical group (5'-P, 3'-P, 3'-OH or…
A: Replication is the process of duplication of DNA. It is a highly efficient process that requires a…
Q: What is the end-replication problem? Why, in the absence of telomerase, do the ends of linear…
A: DNA replication in eukaryotes is semiconservative, semicontinuous, and bidirectional. It occurs in…
Q: In eukaryotes, the DNA replication rate is 50 nucleotides per second. How long would the replication…
A: Nucleotides are the organic molecules consisting of a five carbon sugar (ribose or deoxyribose), a…
Q: What is a true statement about the leading and lagging strands during DNA synthesis? The leading…
A: Ans : Correct statement for the above question is - The lagging strand is created due to DNA…
Q: A bacterium synthesizes DNA at each replication fork at a rate of 1500 nucleotides per second. If…
A: The DNA replication is the process by which new DNA is produced from old DNA and it is usually…
Q: Briefly discuss the pros and cons of having a nucleoid (as bacteria do) versus a double nuclear…
A: Hello, thank you for your question. Since you have posted multiple questions. I am solving the first…
Q: In the following diagram, A and B are two Okazaki fragments generated during DNA replication. Solid…
A: During replication forks, Okazaki fragments are transient components of lagging strand DNA…
Q: On paper, replicate the following segment of DNA: 5’ A T C G G C T A C G T T C A C 3’…
A: DNA replication is a complex process of producing copies of the entire chromosome using the…
Q: When DNA replication was investigated by using heavy, N15 DNA to mark the original molecules, and…
A: DNA replication of phenomenon of formation of new strand of DNA . There are several model of DNA…
Q: In DNA replication, the fundamental reason that Okasaki fragments are produced is that Group of…
A: DNA replication is an important cellular mechanism by which two identical DNA copies are produced…
Q: DNA Replication Explanation Must Include (no essay) Leading strand with 5' and 3' Lagging strand…
A: DNA replications starts offevolved with the disaasembly of DNA strands by using the movement of the…
Q: Match these replication associated terms with the appropriate definition or function. DNA consensus…
A: DNA replication is the process of making two identical copies of DNA from one single parent DNA.
Q: During high stress environments, it has been found that some bacteria activate a genetic mechanism…
A: A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of DNA copying…
Q: Which of the following is NOT TRUE about replication? A. Polynucleotides are made up of…
A: DNA replication in eukaryotes is semiconservative, semicontinuous, and bidirectional. It occurs in…
Q: Using the correct base pairing rules for DNA replication, what would be the complementary strand for…
A: Rules of base pairing A with T: The purine adenine(A) always pairs with the pyrimidine Thymine…
Q: On a piece of paper, replicate the following segment of DNA: 5’ ATCGGCTACGTTCAC 3’…
A: DNA(deoxyribonucleic acid) is a double-stranded helical genetic material that contains thousands of…
Q: Suppose that 22% of the nucleotides of a DNA molecule are deoxyadenosine and during replication the…
A: Suppose that 22% of the nucleotides of a DNA molecule are deoxyadenosine and during replication the…
Q: DnaA proteins bind to repeated binding sites on the DNA double helix, helping to recruit the…
A: Replication is the process by which a double-stranded DNA molecule is copied to produce two…
Q: In the Meselson-Stahl experiment on DNA replication, what fraction of the DNA was composed of one…
A: In 1958, Matthew Meselson and Franklin Stahl performed an experiment which supported the DNA…
Q: 1. (a) An E. cofi DNA plasmid has 5.64 x 10 base pairs. The plasmid contains a single origin and a…
A: DNA replication is the process of producing two identical copies of DNA from one double stranded DNA…
Q: Regarding the process of DNA replication, it is correct to state that: a) Nucleosomes are…
A: Replication is the process where the genetic material is duplicated. This process is important as it…
Step by step
Solved in 2 steps
- (e) What difference would it make to bidirectional DNA replication if both modes of chain extension were equally favourable?(a) How fast does template DNA spin (expressed in revolutions per second) at an E. coli replication fork? (b) What is the velocity of movement (in micrometers per second) of DNA polymerase III holoenzyme relative tothe template?Assume that the sequence of bases shown below is presenton onenucleotide chain of a DNA duplex and that the chain has openedup at a replication fork. Synthesis of an RNA primer occurs on thistemplate starting at the base that is underlined.(a) If the RNA primer consists of eight nucleotides, what is itsbase sequence?(b) In the intact RNA primer, which nucleotide has a free 3'-OHterminus?3'.......GGCTACCTGGATTCA....5'
- a) If you isolated DNA from the ear and the tail of the same mouse, would you expect the DNA, isolated form the two tissue types, to be the same? Why? (2) b) Provide one difference between DNA replication in eukaryotes and prokaryotes with regards to their origin(s) of replication. (1) For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). 14px E EY A Y BIVS Paragraph Arial ABC x² X2 ?次T Te 田田国王 用 图 +](a) Eukaryotic DNA replication is more complex than prokaryotic replication. Give one reason why this should be so. (b) Why might eukaryotic cells need more kinds of DNA polymerases than bacteria?1. On a piece of paper, replicate the following segment of DNA: 5’ ATCGGCTACGTTCAC 3’ 3’ TAGCCGATGCAAGTG 5’ a.) show the direction of replication of the new strands and explain what the lagging and leading strands are. b) Explain how this is semiconservative replication. Are the new strands identical to the original segment of DNA? 2. Createyour own an Illustration of the Central Dogma. Provide your own DNA segment. Use the previous topics as reference.
- 19. Match the letters with the enzymes and macromolecules involved in DNA replication: A E B DNA POLYMERASE CATALYZES COMALENT LINKAGE OF NUCLEOSIDE TRIPHOSPHATE INTO GROWING NEW STRAND INCOMING NUCLEOSIDE D' TRIPHOSPHATE PAIRS WITH A BASE IN THE TEMPLATE STRAND A) i) pyrophosphate (Pi) ii) template strand ii) incoming nucleoside triphosphate iv) new strand v) DNA polymerase1) A bacterial chromosome contains 6.4 million nucleotides of DNA. If synthesis at each replication fork occurs at a rate of 1800 nucleotides per second, how many minutes will it take to completely replicate the chromosome with theta replication? 2) What different mRNA sequences can code for a polypeptide chain with the amino acid sequence Met-Trp-Ile? (Include the stop codon)Suppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in the sequence, and before the gaps were repaired, the fragment in the middle was inverted. Show the sequence of the repaired DNA molecule. Keep the 5’-3’ polarity of the DNA strands and DNA polymerases in mind.) 5’- TAAGCGTAACACGCTAA CAGTAATGCAGAACT GGGTCCTATTTTCGTGCGTACAC – 3’ 3’- ATTCGCATTGTGCGATT GTCATTACGTCTTGA CCCAGGATAAAAGCACGCATGTG -5’ Please note that there are 2 gaps. The second one is between the lines (between T & G in the 1st strand and A & C in the second strand)
- On paper, replicate the following segment of DNA: 5’ A T C G G C T A C G T T C A C 3’ 3’ T A G C C G A T G C A A G T G 5’a. Show the direction of replication of the new strands and explainwhat causes lagging and leading strands to show different patternsof replication.b. Explain how this is semiconservative replication. Are the newstrands identical to the original segment of DNA?What is the basis for the difference in how the leading andlagging strands of DNA molecules are synthesized?(A) The origins of replication occur only at the 5′ end.(B) Helicases and single-strand binding proteins work at the5′ end.(C) DNA polymerase can join new nucleotides only to the3′ end of a pre-existing strand, and the strands areantiparallel.(D) DNA ligase works only in the 3′ S 5′ direction3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.