CRISPROne of the more recent advances in biotechnology is the development of the CRISPR gene modification tool. Match the following descriptions the the key players in thistechnology.NOTE: If you want to change your selection, you'll need to delete the one you already chose. After you delete it, the list of choices will pop back up and you can make adifferent choice.CRISPR technologySpecialized stretches of DNA with nucleotide repeats andCas9 proteinspacersEnzyme that cuts DNAcrRNAGuides the enzyme to the target siteCRISPR DNAAdapted from the natural defense mechanism of bacteria andarchaea

Given information: The CRISPR technology is the most recent advancement in the field of…

Answered: CRISPR One of the more recent advances…

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter13: An Introduction To Genetic Technology

Section: Chapter Questions

Problem 8QP

See similar textbooks

Similar questions

Cloning Genes Is a Multistep Process The following DNA sequence contains a six-base sequence that is a recognition and cutting site for a restriction enzyme. What is this sequence? Which enzyme will cut this sequence? (See Figure 13.5 for help.) 5 CCGAGGAAGCTTAC 3 3 GGCTCCTTCGAATG 5
Cloning Genes Is a Multistep Process In cloning human DNA, why is it necessary to insert the DNA into a vector such as a bacterial plasmid?
A number of advances have been made in biotechnology. CRISPR/Cas9 one of the most controversial, and has had a lot of media attention in recent years. It is a method by which scientists can precisely edit DNA sequences at exact locations. Benefits obviously include the potential to “repair” mutated genes that cause disease. In fact, preliminary results from one of the earliest clinical trials of CRISPR/Cas9 provide evidence that the technique is safe and feasible to use for treating human diseases. What other potential applications of this application do you see (you can use any organisms to illustrate your answer)? What are the potential dangers or downsides of using this technology? Do you think this technology should be used in gene editing in humans? Explain your stance.
CRISPR has the potential to change everything. What potential benefits of this technology are you most excited about? What possible drawbacks concerns you the most?
automated sequencing is used are given a printout of the sense strand of your DNA. The printout is linked. The first thing you need to do is use the correct reading frame. Having done this, the next thing to do is to write out the mRNA sequence using this sense strand reading frame. The last thing to do is to translate the sequence The reading frame DNA sequence is: The mRNA sequence is: The polypeptide sequence is:
Examine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment. Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers. Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand). Please organize your response so that each primer, and associated information, is separated by at least one blank line 5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGAC
What advantages do cDNA libraries provide over genomic DNA libraries? Describe cloning applications where the use of a genomic library is necessary to provide information that a cDNA library cannot.
Biotechnology There are several different tools used to study or manipulate DNA. Match the description to the technology. NOTE: If you want to change your selection, you'll need to delete the one you already chose. After you delete it, the list of choices will pop back up and you can make a different choice. Polymerase Chain Reaction (PCR) Replacing defective genes that caused a disease Gel Electrophoresis Circular DNA used to insert genes Molecular cloning Cuts DNA into smaller pieces Tool for gene editing Restriction enzyme Creates larger quantities of DNA Plasmids Produces genetically identical DNA fragments Separates fragments of DNA by size CRISPR Gene therapy
In biotechnology, gene cloning is a very important technique. A vector is normally required to perform this process. The vector commonly used to transform a bacterial host cell is the plasmid. State the three (3) important regions of the plasmid. Elaborate your answer.
What is complementary base pairing? Be able to figure out the nucleotide sequence of the 2nd strand of DNA if you’re given the first (as happens when DNA replicates); or the RNA sequence that would pair with a DNA sequence (as happens during transcription). What is Biotechnology? Recombinant DNA? What is a restriction enzyme and how is it used to make recombinant DNA? What is a transgenic animal? Transgenic crops? What is Forensics? Why are the following things important in forensic (or medical genetic) testing: PCR? STRs? What is CODIS? What is a multifactorial trait? A polygenic trait? Some examples of each? How do they differ from Mendelian traits? What is cancer? How do cancer cells differ from normal cells? Why is control of the cell cycle crucial? Genetic influences in developing cancer: what is an oncogene? a tumor suppressor? Difference between a benign and a malignant tumore? Metastasis?
During nucleic acid hybridization, the probe is labelled for DNA stability to increase probe-test DNA binding to identify the location of probe and the test DNA binding for amplification
Complete the table below 6. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’-T A C T G A C T GA C G A T C-5’. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence, then transcribe (indicating 5’ and 3’ ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid sequence (indicating the N and C termini). What type of mutation is each?6.a. Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’Complementary DNA sequence:mRNA sequence transcribed from template:Amino acid sequence of peptide:Type of mutation: 6.b. Mutated DNA Template Strand #2: 3’-T A C G G A C T G A C G A T C-5’Complementary DNA sequence:mRNA sequence transcribed from template:Amino acid sequence of peptide:Type of…

SEE MORE QUESTIONS

Recommended textbooks for you

Human Heredity: Principles and Issues (MindTap Co…

Biology

ISBN:

9781305251052

Author:

Michael Cummings

Publisher:

Cengage Learning