7. How many different MRNAS could specify the amino acid sequence met-phe-ser-pro? 8. A gene contains 3 exons and 2 introns. The exons have the following number of base pairs: exon 1 100 bp, exon2 300 bp, exon 3 200 bp. The introns have the following number of base pairs: intron 1 500 bp, intron 2 300 bp. Draw this gene. Represent the exons as boxes and the introns as lines. Assume that the gene as a 5' UTR that is 100 bp in length. Assume it has a 3' UTR that is 200 bp in length.

7. How many different MRNAS could specify the amino acid sequence met-phe-ser-pro? 8. A gene contains 3 exons and 2 introns. The exons have the following number of base pairs: exon 1 100 bp, exon2 300 bp, exon 3 200 bp. The introns have the following number of base pairs: intron 1 500 bp, intron 2 300 bp. Draw this gene. Represent the exons as boxes and the introns as lines. Assume that the gene as a 5' UTR that is 100 bp in length. Assume it has a 3' UTR that is 200 bp in length.

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1VQ

See similar textbooks

Similar questions

1. Given the anticodon in tRNA is CUU, name the amino acid that will be added. 2. Given the anticodon in tRNA is CUU, what is the complementary codon? 3. How many synonyms code for arginine? 4. How many codons code for the amino acid cysteine? 5. How many codons code for the amino acid histidine? 6. How many codons code for the amino acid threonine?
16. Consider the following original coding sequence of a gene that codes for a short 3-amino acid polypeptide: 5'-ATGTGGTCATGA-3' Using the genetic code and the amino acid table below, which of the following sequences arises from a non-conservative missense mutation in the original sequence shown above? First base in codon U C A G UUU UUC- UUA UUG- H₂N+ H H₂N-C- Phe (F) CUU- CCU CUC CCC CUA CCA CUG- CCG AUU ACU AUC Ile (1) ACC AUA ACA AUG Met (M) start ACG- GUU GCU GUC GCC GUA GCA GUG- GCG Nonpolar side chains; hydrophobic Leu (L) U Side chain (R group) OH CH₂ Leu (L) H₂N-C Val (V) HO Glycine (Gly or G) CH3 S CH₂ CH₂ Polar side chains; hydrophilic H O Methionine (Met or M) 0 H₂N-C Second base in codon UCU UCC UCA UCG OH CH, CH HO Aspartic acid (Asp or D) HO Alanine (Ala or A) 0 H O Serine (Ser or S) HO Threonine (Thr or T) Electrically charged side chains; hydrophilic CH3 H₂N-C-C-0- Acidic (negatively charged) CH₂ H₂N+ C CH₂ CH₂ H₂N-C-C-0- H₂N-C- C CH₂ Ser (S) Pro (P) Thr (T) H O…
16. Consider the following original coding sequence of a gene that codes for a short 3-amino acid polypeptide: 5'-ATGTGGTCATGA-3' Using the genetic code and the amino acid table below, which of the following sequences arises from a non-conservative missense mutation in the original sequence shown above? First base in codon U A UUU UUC- UUA UUG- CUU CUC CUA CUG- AUU- ACU AUC Ile (1) ACC AUA- ACA AUG Met (M) start ACG GUU GCU GUC GCC GUA GCA GUG- GCG H₂N- U Phe (F) Leu (L) Leu (L) Nonpolar side chains; hydrophobic Val (V) Side chain (R group) H H₂N-C-C-0- HO Glycine (Gly or G) CH₂ H₂N*- CH₂ CH₂ H O Methionine (Met or M) Polar side chains; hydrophilic 0 CH₂ Second base in codon H O Aspartic acid (Asp or D) UCU UCC UCA UCG CCU CCC CCA CCG Alanine (Ala or A) OH CH₂ H₂N-C C 0 H₂N-C C 0 H O Serine (Ser or S) H O Threonine (Thr or T) Electrically charged side chains; hydrophilic OH CH3 CH -0- H₂N+- Acidic (negatively charged) CH₂ H₂N-C-C-O HO C Ser (S) Pro (P) CH₂ CH₂ Thr (T) CH₂ H₂N-C Ala (A)…
1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence. 2. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. Assumption is that the first amino acid is the N-terminal. 3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. The assumption is that the first amino acid is the N-terminal.
1. A portion of the template strand of a DNA molecule that codes for the 5'-end of an mRNA has the following nucleotide sequence. Give the primary structure of the polypeptide (use 3-letter amino acid codes), beginning with the most common translation initiation codon, that will be specified by this portion of the gene. Be sure to label the ends of the polypeptide. 3'-TTTTACGGGAATTAGAGTCGCAGGATG-5'
Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.
8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for creating the mRNA. Write the corresponding mRNA 5' 3' and translate this mRNA into protein. DNA 3' CCGTGAATACGCTACGGAACTCACTGGTA 5' DNA 5' GGCACTTATGCGATGCCTTGAGTGACCAT 3' mRNA 5' Protein Aline Valine Arginine partic Lysine Asparagine COTOCOAQUC. C FOU U G A Glycine Threonine A GUC A GU G Stop Step Cysteine GTryptophan Phenyl- sarine Lauche C Serie CROUCH UG A C U Hatidine Tyrosine 2060 20/ Leucine Proine
7. The following amino acid sequence represents part of a protein. The normal sequence and a mutant form are shown. By consulting Table 3-1 in your textbook, determine the double-stranded sequence of the corresponding section of the normal gene. Which strand is the strand that RNA polymerase "reads" and copies? What would the sequence of the resulting mRNA be? What kind of mutation is the mutant protein most likely to represent? Normal -lys-arg-his-his-tyr-leu- Mutant 1 -lys-arg-his-his-cys-leu- Geneticists are studying a malfunctioning protein that causes impaired endothelial cell migration and angiogenesis. They have noticed that the amino acid sequence of the protein is truncated compared to normal controls. The mutated mRNA strand is isolated, and analysis shows a mutation located near the 3' end of the coding region. The 3' terminal coding sequence of the abnormal mRNA strand is shown below. 5-...-AUG-ACC-ACU-CCA-CUG-UUG-UUC-CAA-GGG-GAG-AGC-UAG-GUC-CGG- GGC-GGA-AAA-UUU-UAA-3 Using…
1. Create a DNA sequence with eighteen nucleotides. Indicate its 3’ on the left and 5’ on the right since that’s the template strand you will need in the next question to transcribe the mRNA. 2. Transcribe the DNA sequence above and separate the triplets into codons. Indicate 5’ and 3’ in the correct location on the strand. (Don’t worry about splicing- assume that the pre- mRNA is the same as the mature mRNA sequence) 3. Look at the genetic code, and indicate which amino acid is coded for by the codons in the above mRNA. 4. ANSWER BELOW QUESTIONS: A. First write the original DNA strand. Indicate where the substitution was by either circling it or writing it in a different color. Then write the mutated DNA sequence with the point mutation (aka substitution) wherever you choose for it to be. Again, circle it or write it in a different color. Do the same for the transcribed mRNA. Repeat the directions for 2 and 3 for this new DNA stand. (i.e., include the mRNA and translated protein…
2. The 64 codons are shown in Table 1. Notice that the first two nucleotides of each codon (abbreviated by their first letter) are shown in the column on the left. To find out the amino acid specified by a given codon, find the first two letters in the column on the left, then follow that row to the column showing the last nucleotide (letter) of the codon. Note that most amino acids are coded for by more than one codon. Table 1. The Genetic Code: Codons and Their Amino Acids First Two Mocleotides af Codons Last Nocleotide of Codons A The Amino Acids phe phe leu leu Abbreviations Names UC gly glycine alanine ser ser ser ser ala UA tyr tyr term term val valine UG cys cys term trp ile isoleucine cu leu leu leu leu leu leucine serine threonine ser CC pro pro pro pro thr gin proline aspartate glutamate lysine arginine asparagine glutamine cysteine methionine CA his his gin pro asp CG arg arg arg arg glu lys AU ile ile ile met AC thr thr thr thr arg asn AA asn asn lys lys gln AG ser ser arg…
1. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.) 2. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.)
1. Given the piece of MRNA: 5'-CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCC-3' 1. Predict the DNA strand sequence from which it was transcribe 2. List the complementary non-coding DNA Sequence 3. List the Amino acid Sequence of the protein coded for. Use the Genetic Code 2. Below is a short segment of a DNA molecule. Translate the DNA codon into MRNA. 5'- TACCATGAGAATTGTGG TCACCTTTTT-3' 3'- ATGGTACTCTTAACACCAGTGGAAAA A-5' MRNA Sequence Amino Acid Sequence